Difference between revisions of "Cicer arietinum"

From ICG
Jump to navigation Jump to search
 
(19 intermediate revisions by 8 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
  
−
[[File:REFqPCR2016014-1.JPG|right|227px|]]
+
[[File:Cicer arietinum.png|right|200px|link=Cicer arietinum]]
−
* Chickpea is an important food legume of the semi-arid tropical (SAT) regions of the world, known to be a nutraceutical (or health benefiting food) because of its high nutritional value. Despite growing demand and high yield potential, chickpea yield is unstable and productivity is stagnant at unacceptably low levels due to constraints such as abiotic stresses (drought, heat, cold and high-salinity) and biotic stresses (Ascochyta blight, Fusarium wilt and pod borer).
+
* '''''Cicer arietinum''''' is an important food legume of the semi-arid tropical (SAT) regions of the world, known to be a health benefiting food because of its high nutritional value. Despite growing demand and high yield potential, its unstable yield and productivity is stagnant at unacceptably low levels due to constraints such as abiotic stresses (drought, heat, cold and high-salinity) and biotic stresses (Ascochyta blight, Fusarium wilt and pod borer). Cultivation with sodium metavanadate, sodium chloride or sodium sulfate in the early stage can increase its concentration of formononetin, ononin, daidzein and biochanin A glucoside contents <ref name="ref1"/> <ref name="ref2"/> <ref name="ref3"/>.
−
* chickpeas germinated in presence of sodium metavanadate increased 32% and 11% the formononetin and biochanin A contents, respectively. Also a combination of sodium chloride and sodium sulfate, used during chickpea soaking before 4 germination days, increased the concentration of ononin, daidzein and biochanin A glucoside by 71%, 11% and 13%, respectively, compared with the germinated control. <ref name="ref1"/> <ref name="ref2"/> <ref name="ref3"/>.
+
* <font color=blue>'''Common Name:'''</font> '''Chickpea'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3827 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Across Cultivated and Wild Species'''''==
 
=='''''Across Cultivated and Wild Species'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 14:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 25: Line 26:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TGGAGCCCAATTACAAAAGC
 
* F:TGGAGCCCAATTACAAAAGC
−
* R:TGGAGCCCAATTACAAAAGC
+
* R:TTTGAAGCCAAAGAGGCAAC
 
|align="center"|  138  
 
|align="center"|  138  
 
|align="center"| 62
 
|align="center"| 62
Line 37: Line 38:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ACAACGATACCAGGGTGTTACC
 
* F:ACAACGATACCAGGGTGTTACC
−
* R:ACAACGATACCAGGGTGTTACC
+
* R:TCTCCCATGATGCCTTTAACTC
 
|align="center"|  116  
 
|align="center"|  116  
 
|align="center"| 62
 
|align="center"| 62
Line 49: Line 50:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GTTGTACTTCGGGAGAGTTGCT
 
* F:GTTGTACTTCGGGAGAGTTGCT
−
* R:GTTGTACTTCGGGAGAGTTGCT
+
* R:GGAGCTTCTGGCTTATGATGCT
 
|align="center"|  115  
 
|align="center"|  115  
 
|align="center"| 62
 
|align="center"| 62
Line 61: Line 62:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TCACAGGTTGTGATGGAGTCTG
 
* F:TCACAGGTTGTGATGGAGTCTG
−
* R:TCACAGGTTGTGATGGAGTCTG
+
* R:CCTCAAATCTTGTTGGGGTGTC
 
|align="center"|  135  
 
|align="center"|  135  
 
|align="center"| 62
 
|align="center"| 62
Line 67: Line 68:
 
|}
 
|}
  
−
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 80: Line 82:
  
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''9''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=17132640821263345199&as_sdt=2005&sciodt=0,5&hl=en '''9'''] (Based on Google Scholar [2017-09-01])
  
 
=='''Different Developmental Stages & Abiotic Stress'''==
 
=='''Different Developmental Stages & Abiotic Stress'''==
Line 91: Line 93:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 99: Line 101:
 
|align="center"| Elongation factor 1-alpha
 
|align="center"| Elongation factor 1-alpha
 
|
 
|
−
*Various organs developmental stages;
+
*Various organs developmental stages
 
*Various stress conditions
 
*Various stress conditions
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AJ004960 '''AJ004960''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AJ004960 '''AJ004960''']  
Line 134: Line 136:
 
|}
 
|}
  
−
===Moleculer Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 142: Line 145:
 
*'''Email''': mjainanid@gmail.com  
 
*'''Email''': mjainanid@gmail.com  
 
*'''Institution''': National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, New Delhi 110 067, India
 
*'''Institution''': National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, New Delhi 110 067, India
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=7460091868871764874&as_sdt=2005&sciodt=0,5&hl=en '''104'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 155: Line 160:
 
</ref>
 
</ref>
 
</references>
 
</references>
−
 
+
=='''Categories'''==
 
[[Category:Plants]]
 
[[Category:Plants]]
−
[[Category:mRNA]]　
+
[[Category:mRNA]][[Category:SYBR]]
−
[[Category:SYBR]]
 
 
[[Category:ABCT]] [[Category:EF1α]] [[Category:G6PD]] [[Category:GAPDH]] [[Category:HSP90]] [[Category:TIP41]] [[Category:UCP]]
 
[[Category:ABCT]] [[Category:EF1α]] [[Category:G6PD]] [[Category:GAPDH]] [[Category:HSP90]] [[Category:TIP41]] [[Category:UCP]]
 +
[[Category:Cultivated & Wild Species]]  [[Category:Abiotic Stress]]  [[Category:Different Developmental Stages]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:RefFinder]]

Latest revision as of 09:06, 1 September 2017

Description

Cicer arietinum.png
  • Cicer arietinum is an important food legume of the semi-arid tropical (SAT) regions of the world, known to be a health benefiting food because of its high nutritional value. Despite growing demand and high yield potential, its unstable yield and productivity is stagnant at unacceptably low levels due to constraints such as abiotic stresses (drought, heat, cold and high-salinity) and biotic stresses (Ascochyta blight, Fusarium wilt and pod borer). Cultivation with sodium metavanadate, sodium chloride or sodium sulfate in the early stage can increase its concentration of formononetin, ononin, daidzein and biochanin A glucoside contents [1] [2] [3].
  • Common Name: Chickpea
  • NCBI Taxonomy

Across Cultivated and Wild Species

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
UCP[1] Uncharacterized conserved protein
  • Across different genotypes
 XM_004505295
  • F:TGGAGCCCAATTACAAAAGC
  • R:TTTGAAGCCAAAGAGGCAAC
 138 62 SYBR
G6PD[1] Glucose-6-phosphate 1-dehydrogenase
  • Across different genotypes
 XM_004515773
  • F:ACAACGATACCAGGGTGTTACC
  • R:TCTCCCATGATGCCTTTAACTC
 116 62 SYBR
TIP41[1] Tonoplast intrinsic proteins -like protein
  • Abiotic stress conditions
 XM_004496854
  • F:GTTGTACTTCGGGAGAGTTGCT
  • R:GGAGCTTCTGGCTTATGATGCT
 115 62 SYBR
ABCT[1] ATP-binding cassette transporter
  • Universal reference gene
 XM_004505589
  • F:TCACAGGTTGTGATGGAGTCTG
  • R:CCTCAAATCTTGTTGGGGTGTC
 135 62 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pooja Bhatnagar-Mathur
  • Email: p.bhatnagar@cgiar.org
  • Institution: Genetic Transformation Laboratory, International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru-502324, Telangana, India

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-09-01])

Different Developmental Stages & Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
EF1α[2] Elongation factor 1-alpha
  • Various organs developmental stages
  • Various stress conditions
 AJ004960
  • F:TCCACCACTTGGTCGTTTTG
  • R:CTTAATGACACCGACAGCAACAG
 64 60 SYBR
HSP90[2] Heat shock protein 90
  • Various organs developmental stages
 GR406804
  • F:GCAGCATGGCTGGTTACATGT
  • R:GCAGCATGGCTGGTTACATGT
 63 60 SYBR
GAPDH[2] Glyceraldehyde-3-phosphate dehydrogenase
  • Various stress conditions
 AJ010224
  • F:CCAAGGTCAAGATCGGAATCA
  • R:CAAAGCCACTCTAGCAACCAAA
 65 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Mukesh Jain
  • Email: mjainanid@gmail.com
  • Institution: National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, New Delhi 110 067, India

Citation Statistics

Cited by 104 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 Reddy DS, Bhatnagar-Mathur P, Reddy PS, et al. (2016) Identification and Validation of Reference Genes and Their Impact on Normalized Gene Expression Studies across Cultivated and Wild Cicer Species. PLoS One 11, e0148451.
  2. ↑ 2.0 2.1 2.2 2.3 Garg R, Sahoo A, Tyagi A K, et al. Validation of internal control genes for quantitative gene expression studies in chickpea (Cicer arietinum L.)[J]. Biochemical and biophysical research communications, 2010, 396(2): 283-288.
  3. ↑ Guardado-Felix D, Serna-Saldivar SO, Cuevas-Rodriguez EO, Jacobo-Velazquez DA, Gutierrez-Uribe JA (2017) Effect of sodium selenite on isoflavonoid contents and antioxidant capacity of chickpea (Cicer arietinum L.) sprouts. Food Chem 226, 69-74.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Cicer_arietinum&oldid=8829"