Difference between revisions of "Cicer arietinum"
Jump to navigation
Jump to search
Wangzhennan (talk | contribs) |
|||
(29 intermediate revisions by 9 users not shown) | |||
Line 1: | Line 1: | ||
==Description== | ==Description== | ||
− | [[File: | + | [[File:Cicer arietinum.png|right|200px|link=Cicer arietinum]] |
− | * | + | * '''''Cicer arietinum''''' is an important food legume of the semi-arid tropical (SAT) regions of the world, known to be a health benefiting food because of its high nutritional value. Despite growing demand and high yield potential, its unstable yield and productivity is stagnant at unacceptably low levels due to constraints such as abiotic stresses (drought, heat, cold and high-salinity) and biotic stresses (Ascochyta blight, Fusarium wilt and pod borer). Cultivation with sodium metavanadate, sodium chloride or sodium sulfate in the early stage can increase its concentration of formononetin, ononin, daidzein and biochanin A glucoside contents <ref name="ref1"/> <ref name="ref2"/> <ref name="ref3"/>. |
− | + | * <font color=blue>'''Common Name:'''</font> '''Chickpea''' | |
+ | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3827 <font color=blue>'''NCBI Taxonomy'''</font>] | ||
=='''''Across Cultivated and Wild Species'''''== | =='''''Across Cultivated and Wild Species'''''== | ||
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 13: | Line 14: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 25: | Line 26: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:TGGAGCCCAATTACAAAAGC | * F:TGGAGCCCAATTACAAAAGC | ||
− | * R: | + | * R:TTTGAAGCCAAAGAGGCAAC |
|align="center"| 138 | |align="center"| 138 | ||
|align="center"| 62 | |align="center"| 62 | ||
Line 37: | Line 38: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:ACAACGATACCAGGGTGTTACC | * F:ACAACGATACCAGGGTGTTACC | ||
− | * R: | + | * R:TCTCCCATGATGCCTTTAACTC |
|align="center"| 116 | |align="center"| 116 | ||
|align="center"| 62 | |align="center"| 62 | ||
Line 49: | Line 50: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GTTGTACTTCGGGAGAGTTGCT | * F:GTTGTACTTCGGGAGAGTTGCT | ||
− | * R: | + | * R:GGAGCTTCTGGCTTATGATGCT |
|align="center"| 115 | |align="center"| 115 | ||
|align="center"| 62 | |align="center"| 62 | ||
Line 61: | Line 62: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:TCACAGGTTGTGATGGAGTCTG | * F:TCACAGGTTGTGATGGAGTCTG | ||
− | * R: | + | * R:CCTCAAATCTTGTTGGGGTGTC |
|align="center"| 135 | |align="center"| 135 | ||
|align="center"| 62 | |align="center"| 62 | ||
Line 67: | Line 68: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
*mRNA | *mRNA | ||
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 79: | Line 81: | ||
*'''Institution''': Genetic Transformation Laboratory, International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru-502324, Telangana, India | *'''Institution''': Genetic Transformation Laboratory, International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru-502324, Telangana, India | ||
− | ==Citation Statistics== | + | ===Citation Statistics=== |
− | Cited by '''0''' (Based on Google Scholar [2017- | + | Cited by [https://scholar.google.com/scholar?cites=17132640821263345199&as_sdt=2005&sciodt=0,5&hl=en '''9'''] (Based on Google Scholar [2017-09-01]) |
+ | |||
+ | =='''Different Developmental Stages & Abiotic Stress'''== | ||
+ | |||
+ | ===Reference Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primers (5'-3')<br>[Forward/Reverse] | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| EF1α<ref name="ref2"/> | ||
+ | |align="center"| Elongation factor 1-alpha | ||
+ | | | ||
+ | *Various organs developmental stages | ||
+ | *Various stress conditions | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AJ004960 '''AJ004960'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:TCCACCACTTGGTCGTTTTG | ||
+ | * R:CTTAATGACACCGACAGCAACAG | ||
+ | |align="center"| 64 | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| HSP90<ref name="ref2"/> | ||
+ | |align="center"| Heat shock protein 90 | ||
+ | | | ||
+ | *Various organs developmental stages | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR406804 '''GR406804'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GCAGCATGGCTGGTTACATGT | ||
+ | * R:GCAGCATGGCTGGTTACATGT | ||
+ | |align="center"| 63 | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| GAPDH<ref name="ref2"/> | ||
+ | |align="center"| Glyceraldehyde-3-phosphate dehydrogenase | ||
+ | | | ||
+ | *Various stress conditions | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AJ010224 '''AJ010224'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CCAAGGTCAAGATCGGAATCA | ||
+ | * R:CAAAGCCACTCTAGCAACCAAA | ||
+ | |align="center"| 65 | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | |||
+ | ===Molecular Types=== | ||
+ | * mRNA | ||
+ | |||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | ===Contact=== | ||
+ | *'''Name''': Mukesh Jain | ||
+ | *'''Email''': mjainanid@gmail.com | ||
+ | *'''Institution''': National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, New Delhi 110 067, India | ||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=7460091868871764874&as_sdt=2005&sciodt=0,5&hl=en '''104'''] (Based on Google Scholar [2017-09-01]) | ||
=='''References'''== | =='''References'''== | ||
Line 88: | Line 154: | ||
</ref> | </ref> | ||
<ref name="ref2"> | <ref name="ref2"> | ||
− | + | Garg R, Sahoo A, Tyagi A K, et al. Validation of internal control genes for quantitative gene expression studies in chickpea (Cicer arietinum L.)[J]. Biochemical and biophysical research communications, 2010, 396(2): 283-288. | |
</ref> | </ref> | ||
<ref name="ref3"> | <ref name="ref3"> | ||
Line 94: | Line 160: | ||
</ref> | </ref> | ||
</references> | </references> | ||
+ | =='''Categories'''== | ||
+ | [[Category:Plants]] | ||
+ | [[Category:mRNA]][[Category:SYBR]] | ||
+ | [[Category:ABCT]] [[Category:EF1α]] [[Category:G6PD]] [[Category:GAPDH]] [[Category:HSP90]] [[Category:TIP41]] [[Category:UCP]] | ||
+ | [[Category:Cultivated & Wild Species]] [[Category:Abiotic Stress]] [[Category:Different Developmental Stages]] | ||
− | [[Category: | + | [[Category:geNorm]] |
+ | [[Category:NormFinder]] | ||
+ | [[Category:RefFinder]] |
Latest revision as of 09:06, 1 September 2017
Contents
Description
- Cicer arietinum is an important food legume of the semi-arid tropical (SAT) regions of the world, known to be a health benefiting food because of its high nutritional value. Despite growing demand and high yield potential, its unstable yield and productivity is stagnant at unacceptably low levels due to constraints such as abiotic stresses (drought, heat, cold and high-salinity) and biotic stresses (Ascochyta blight, Fusarium wilt and pod borer). Cultivation with sodium metavanadate, sodium chloride or sodium sulfate in the early stage can increase its concentration of formononetin, ononin, daidzein and biochanin A glucoside contents [1] [2] [3].
- Common Name: Chickpea
- NCBI Taxonomy
Across Cultivated and Wild Species
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
UCP[1] | Uncharacterized conserved protein |
|
XM_004505295 |
|
138 | 62 | SYBR |
G6PD[1] | Glucose-6-phosphate 1-dehydrogenase |
|
XM_004515773 |
|
116 | 62 | SYBR |
TIP41[1] | Tonoplast intrinsic proteins -like protein |
|
XM_004496854 |
|
115 | 62 | SYBR |
ABCT[1] | ATP-binding cassette transporter |
|
XM_004505589 |
|
135 | 62 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- Ref-Finder method && Related Reference
Contact
- Name: Pooja Bhatnagar-Mathur
- Email: p.bhatnagar@cgiar.org
- Institution: Genetic Transformation Laboratory, International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru-502324, Telangana, India
Citation Statistics
Cited by 9 (Based on Google Scholar [2017-09-01])
Different Developmental Stages & Abiotic Stress
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
EF1α[2] | Elongation factor 1-alpha |
|
AJ004960 |
|
64 | 60 | SYBR |
HSP90[2] | Heat shock protein 90 |
|
GR406804 |
|
63 | 60 | SYBR |
GAPDH[2] | Glyceraldehyde-3-phosphate dehydrogenase |
|
AJ010224 |
|
65 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: Mukesh Jain
- Email: mjainanid@gmail.com
- Institution: National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, New Delhi 110 067, India
Citation Statistics
Cited by 104 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 1.4 Reddy DS, Bhatnagar-Mathur P, Reddy PS, et al. (2016) Identification and Validation of Reference Genes and Their Impact on Normalized Gene Expression Studies across Cultivated and Wild Cicer Species. PLoS One 11, e0148451.
- ↑ 2.0 2.1 2.2 2.3 Garg R, Sahoo A, Tyagi A K, et al. Validation of internal control genes for quantitative gene expression studies in chickpea (Cicer arietinum L.)[J]. Biochemical and biophysical research communications, 2010, 396(2): 283-288.
- ↑ Guardado-Felix D, Serna-Saldivar SO, Cuevas-Rodriguez EO, Jacobo-Velazquez DA, Gutierrez-Uribe JA (2017) Effect of sodium selenite on isoflavonoid contents and antioxidant capacity of chickpea (Cicer arietinum L.) sprouts. Food Chem 226, 69-74.