Difference between revisions of "Cicer arietinum"
Jump to navigation
Jump to search
Line 81: | Line 81: | ||
==Citation Statistics== | ==Citation Statistics== | ||
Cited by '''9''' (Based on Google Scholar [2017-06-01]) | Cited by '''9''' (Based on Google Scholar [2017-06-01]) | ||
+ | |||
+ | =='''Different Tissues'''== | ||
+ | |||
+ | ===Reference Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primer | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| EF1α<ref name="ref1"/> | ||
+ | |align="center"| Elongation factor 1-alpha | ||
+ | | | ||
+ | *various organs developmental stages;* various stress conditions | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AJ004960 '''AJ004960'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:TCCACCACTTGGTCGTTTTG | ||
+ | * R:CTTAATGACACCGACAGCAACAG | ||
+ | |align="center"| 64 | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| HSP90<ref name="ref1"/> | ||
+ | |align="center"| Heat shock protein 90 | ||
+ | | | ||
+ | *various organs developmental stages | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR406804 '''GR406804'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GCAGCATGGCTGGTTACATGT | ||
+ | * R:GCAGCATGGCTGGTTACATGT | ||
+ | |align="center"| 63 | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| GAPDH<ref name="ref1"/> | ||
+ | |align="center"| Glyceraldehyde-3-phosphate dehydrogenase | ||
+ | | | ||
+ | *various stress conditions | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AJ010224 '''AJ010224'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CCAAGGTCAAGATCGGAATCA | ||
+ | * R:CAAAGCCACTCTAGCAACCAAA | ||
+ | |align="center"| 65 | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | ===Moleculer Type=== | ||
+ | * mRNA | ||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | ===Contact=== | ||
+ | *'''Name''': Mukesh Jain | ||
+ | *'''Email''': mjainanid@gmail.com | ||
+ | *'''Institution''': National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, New Delhi 110 067, India | ||
=='''References'''== | =='''References'''== |
Revision as of 13:15, 16 June 2017
Contents
Description
- Chickpea is an important food legume of the semi-arid tropical (SAT) regions of the world, known to be a nutraceutical (or health benefiting food) because of its high nutritional value. Despite growing demand and high yield potential, chickpea yield is unstable and productivity is stagnant at unacceptably low levels due to constraints such as abiotic stresses (drought, heat, cold and high-salinity) and biotic stresses (Ascochyta blight, Fusarium wilt and pod borer).
- chickpeas germinated in presence of sodium metavanadate increased 32% and 11% the formononetin and biochanin A contents, respectively. Also a combination of sodium chloride and sodium sulfate, used during chickpea soaking before 4 germination days, increased the concentration of ononin, daidzein and biochanin A glucoside by 71%, 11% and 13%, respectively, compared with the germinated control. [1] [2] [3].
Across Cultivated and Wild Species
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
UCP[1] | Uncharacterized conserved protein |
|
XM_004505295 |
|
138 | 62 | SYBR |
G6PD[1] | Glucose-6-phosphate 1-dehydrogenase |
|
XM_004515773 |
|
116 | 62 | SYBR |
TIP41[1] | Tonoplast intrinsic proteins -like protein |
|
XM_004496854 |
|
115 | 62 | SYBR |
ABCT[1] | ATP-binding cassette transporter |
|
XM_004505589 |
|
135 | 62 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- Ref-Finder method && Related Reference
Contact
- Name: Pooja Bhatnagar-Mathur
- Email: p.bhatnagar@cgiar.org
- Institution: Genetic Transformation Laboratory, International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru-502324, Telangana, India
Citation Statistics
Cited by 9 (Based on Google Scholar [2017-06-01])
Different Tissues
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
EF1α[1] | Elongation factor 1-alpha |
|
AJ004960 |
|
64 | 60 | SYBR |
HSP90[1] | Heat shock protein 90 |
|
GR406804 |
|
63 | 60 | SYBR |
GAPDH[1] | Glyceraldehyde-3-phosphate dehydrogenase |
|
AJ010224 |
|
65 | 60 | SYBR |
Moleculer Type
- mRNA
Evaluation Methods
Contact
- Name: Mukesh Jain
- Email: mjainanid@gmail.com
- Institution: National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, New Delhi 110 067, India
References
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Reddy DS, Bhatnagar-Mathur P, Reddy PS, et al. (2016) Identification and Validation of Reference Genes and Their Impact on Normalized Gene Expression Studies across Cultivated and Wild Cicer Species. PLoS One 11, e0148451.
- ↑ Jogihalli P, Singh L, Sharanagat VS (2017) Effect of microwave roasting parameters on functional and antioxidant properties of chickpea (Cicer arietinum). LWT - Food Science and Technology 79, 223-233.
- ↑ Guardado-Felix D, Serna-Saldivar SO, Cuevas-Rodriguez EO, Jacobo-Velazquez DA, Gutierrez-Uribe JA (2017) Effect of sodium selenite on isoflavonoid contents and antioxidant capacity of chickpea (Cicer arietinum L.) sprouts. Food Chem 226, 69-74.