Difference between revisions of "Cichorium intybus"

From ICG
Jump to navigation Jump to search
Line 115: Line 115:
 
</references>
 
</references>
 
[[Category:Plants]]
 
[[Category:Plants]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 07:45, 19 June 2017

Description

REFqPCR2015014-1.jpg
  • Industrial chicory (Cichorium intybus L. var sativum) is a member of the Asteraceae family widely used for inulin production in northwestern Europe, India, South Africa, and Chile. Its roots are also processed to prepare dried or roasted products or beverages. Chicory, an important crop in the region Nord-Pas-de-Calais, France, accumulates four major polyphenols: chlorogenic, isochlorogenic, caftaric, and chicoric acids.
  • The genus Cichorium (Asteraceae) is made up of six species with major geographical presence in Europe and Asia. Cichorium intybus, commonly known as chicory, is well known as a coffee substitute but is also widely used medicinally to treat various ailments ranging from wounds to diabetes.
  • Although this plant has a rich history of use in folklore, many of its constituents have not been explored for their pharmacological potential. Toxicological data on C. intybus is currently limited. This review focuses on the economic and culturally important medicinal uses of C. intybus. Traditional uses, scientific validation, and phytochemical composition are discussed in detail. [1] [2].

Vrious Condition & Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TIP41[1] TIP41 like protein
  • Cell cultures grown under various conditions
EH681285.1
  • F:GTTGGGTGCGCATCTCTAAT
  • R:GTTGGGTGCGCATCTCTAAT
100 84 SYBR
Clath[1] Clathrin adaptator complex subunit
  • Seedlings
EH684142.1
  • F:TGCTTCCGCCATCTACTTTT
  • R:TGCTTCCGCCATCTACTTTT
128 80.5 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: David Gagneul
  • Email: david.gagneul@univ-lille1.fr
  • Institution: Université Lille, INRA, ISA, Université d’Artois, Université du Littoral Côte d’Opale, EA 7394 – ICV – Institut Charles Viollette, Lille, France

Citation Statistics

Cited by 14 (Based on Google Scholar [2017-06-01])

Leaf & Root

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT[2] actin

chicory root and leaf tissues

EF528575
  • F:CCAAATCCAGCTCATCAGTCG
  • R:TCTTTCGGCTCCGATGGTGAT
74 80.26 SYBR
EF[2] elongation factor 1-alpha

chicory root and leaf tissues

AY378166
  • F:CATGCGTCAGACGGTTGCTGT
  • R:CTTCACTCCCTTCTTGGCTGC
100 82.17 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Marc De Loose
  • Email: marc.deloose@ilvo.vlaanderen.be
  • Institution: Institute for Agricultural and Fisheries Research (ILVO), Burg Van Gansberghelaan 115 bus 1, 9820 Merelbeke, Belgium

References

  1. 1.0 1.1 1.2 Delporte M, Legrand G, Hilbert JL, Gagneul D (2015) Selection and validation of reference genes for quantitative real-time PCR analysis of gene expression in Cichorium intybus. Front Plant Sci 6, 651.
  2. 2.0 2.1 2.2 Maroufi A, Van Bockstaele E, De Loose M. Validation of reference genes for gene expression analysis in chicory (Cichorium intybus) using quantitative real-time PCR[J]. BMC molecular biology, 2010, 11(1): 15.