Difference between revisions of "Citrullus lanatus"

From ICG
Jump to navigation Jump to search
 
(7 intermediate revisions by 4 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2015028-1.jpg|right|327px|]]
+
[[File:Citrullus lanatus.png|right|200px|link=Citrullus lanatus]]
* Watermelon (Citrullus lanatus) is a popular and economically important horticultural crop in terms of production and consumption. During development and ripening, watermelon fruits undergo various physiological and biochemical changes, resulting in diverse sizes, colors, shapes, sweetness, textures, and aromas.
+
*'''''Citrullus lanatus''''' is a popular and economically important horticultural crop in terms of production and consumption. Watermelon is gaining popularity as a model plant for studying non-climacteric fruits. Cultivated watermelon is an important agriculture crop world-wide. The fruit of watermelon undergoes distinct stages of development with dramatic changes in its size, color, sweetness, texture and aroma<ref name="ref1"/><ref name="ref2"/>.
* Watermelon is gaining popularity as a model plant for studying non-climacteric fruits. Studies have focused on the unique metabolic and regulatory networks of watermelon fruit to improve the crucial nutritional attributes of this fruit.
+
* <font color=blue>'''Common Name:'''</font> '''Watermelon'''
* Cultivated watermelon is an important agriculture crop world-wide. The fruit of watermelon undergoes distinct stages of development with dramatic changes in its size, color, sweetness, texture and aroma. <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3654 <font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
 
=='''''Fruit Development'''''==
 
=='''''Fruit Development'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 77: Line 78:
 
*'''Institution''': Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan, China
 
*'''Institution''': Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''7''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=16048567919141803987&as_sdt=2005&sciodt=0,5&hl=en '''8'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 88: Line 89:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Plants]]
 
[[Category:Plants]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
Line 93: Line 95:
 
[[Category:ACT]] [[Category:CACS]] [[Category:SAND]] [[Category:Tubulin]]
 
[[Category:ACT]] [[Category:CACS]] [[Category:SAND]] [[Category:Tubulin]]
 
[[Category:Fruit Development]]
 
[[Category:Fruit Development]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 09:13, 1 September 2017

Description

Citrullus lanatus.png
  • Citrullus lanatus is a popular and economically important horticultural crop in terms of production and consumption. Watermelon is gaining popularity as a model plant for studying non-climacteric fruits. Cultivated watermelon is an important agriculture crop world-wide. The fruit of watermelon undergoes distinct stages of development with dramatic changes in its size, color, sweetness, texture and aroma[1][2].
  • Common Name: Watermelon
  • NCBI Taxonomy

Fruit Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ClCAC[1] Clathrin adaptor complex subunit
  • Effects of genotype, fruit setting method and developmental stage
Cla016178
  • F:GAACTTGGCACCTGTCCTGT
  • R:GAACAGTGCAACAGCCTCAA
147 60 SYBR
ClTUA5[1] Alpha tubulin 5
  • Effects of genotype, fruit setting method and developmental stage
Cla003129
  • F:GATGGTATGATGCCCAGTGA
  • R:CCGGTAGGCTCCAGTTCTAA
156 60 SYBR
ClACT[1] β-actin
  • Effects of genotype, fruit setting method and developmental stage
Cla003129
  • F:CCATGTATGTTGCCATCCAG
  • R:GGATAGCATGGGGTAGAGCA
NA 60 SYBR
ClSAND[1] SAND family protein
  • Effects of genotype, fruit setting method and developmental stage
Cla001870
  • F:TGCAAACATAAGGTTATCAGTCTTG
  • R:GCATACAAAAACGCCATAGGA
168 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhilong Bie
  • Email: biezhilong@hotmail.com
  • Institution: Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan, China

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Kong Q, Yuan J, Gao L, et al. (2015) Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development. PLoS One 10, e0130865.
  2. Guo SG, Liu JA, Zheng Y, et al. (2011) Characterization of transcriptome dynamics during watermelon fruit development: sequencing, assembly, annotation and gene expression profiles. BMC Genomics 12.

Categories