Citrullus lanatus

From ICG
Jump to navigation Jump to search

Description

REFqPCR2015028-1.jpg
  • Watermelon (Citrullus lanatus) is a popular and economically important horticultural crop in terms of production and consumption. During development and ripening, watermelon fruits undergo various physiological and biochemical changes, resulting in diverse sizes, colors, shapes, sweetness, textures, and aromas.
  • Watermelon is gaining popularity as a model plant for studying non-climacteric fruits. Studies have focused on the unique metabolic and regulatory networks of watermelon fruit to improve the crucial nutritional attributes of this fruit.
  • Cultivated watermelon is an important agriculture crop world-wide. The fruit of watermelon undergoes distinct stages of development with dramatic changes in its size, color, sweetness, texture and aroma. [1] [2].

Fruit Development

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ClCAC[1] Clathrin adaptor complex subunit
  • Effects of genotype, fruit setting method and developmental stage
Cla016178
  • F:GAACTTGGCACCTGTCCTGT
  • R:GAACTTGGCACCTGTCCTGT
147 60 SYBR
ClTUA5[1] Alpha tubulin 5
  • Effects of genotype, fruit setting method and developmental stage
Cla003129
  • F:GATGGTATGATGCCCAGTGA
  • R:GATGGTATGATGCCCAGTGA
156 60 SYBR
ClACT[1] β-actin
  • Effects of genotype, fruit setting method and developmental stage
Cla003129
  • F:CCATGTATGTTGCCATCCAG
  • R:CCATGTATGTTGCCATCCAG
NA 60 SYBR
ClSAND[1] SAND family protein
  • Effects of genotype, fruit setting method and developmental stage
Cla001870
  • F:TGCAAACATAAGGTTATCAGTCTTG
  • R:TGCAAACATAAGGTTATCAGTCTTG
168 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhilong Bie
  • Email: biezhilong@hotmail.com
  • Institution: Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan, China

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 Kong Q, Yuan J, Gao L, et al. (2015) Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development. PLoS One 10, e0130865.
  2. Guo SG, Liu JA, Zheng Y, et al. (2011) Characterization of transcriptome dynamics during watermelon fruit development: sequencing, assembly, annotation and gene expression profiles. BMC Genomics 12.