Citrullus lanatus

Description

Citrullus lanatus is a popular and economically important horticultural crop in terms of production and consumption. Watermelon is gaining popularity as a model plant for studying non-climacteric fruits. Cultivated watermelon is an important agriculture crop world-wide. The fruit of watermelon undergoes distinct stages of development with dramatic changes in its size, color, sweetness, texture and aroma^[1]^[2].
Common Name: Watermelon
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
ClCAC^[1]	Clathrin adaptor complex subunit	Effects of genotype, fruit setting method and developmental stage	Cla016178	F:GAACTTGGCACCTGTCCTGT R:GAACAGTGCAACAGCCTCAA	147	60	SYBR
ClTUA5^[1]	Alpha tubulin 5	Effects of genotype, fruit setting method and developmental stage	Cla003129	F:GATGGTATGATGCCCAGTGA R:CCGGTAGGCTCCAGTTCTAA	156	60	SYBR
ClACT^[1]	β-actin	Effects of genotype, fruit setting method and developmental stage	Cla003129	F:CCATGTATGTTGCCATCCAG R:GGATAGCATGGGGTAGAGCA	NA	60	SYBR
ClSAND^[1]	SAND family protein	Effects of genotype, fruit setting method and developmental stage	Cla001870	F:TGCAAACATAAGGTTATCAGTCTTG R:GCATACAAAAACGCCATAGGA	168	60	SYBR

Name: Zhilong Bie
Email: biezhilong@hotmail.com
Institution: Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan, China

Cited by 8 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 Kong Q, Yuan J, Gao L, et al. (2015) Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development. PLoS One 10, e0130865.
↑ Guo SG, Liu JA, Zheng Y, et al. (2011) Characterization of transcriptome dynamics during watermelon fruit development: sequencing, assembly, annotation and gene expression profiles. BMC Genomics 12.