Difference between revisions of "Citrus clementina"

From ICG
Jump to navigation Jump to search
Line 56: Line 56:
 
|}
 
|}
  
===Moleculer Type===
+
===Molecular Type===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']

Revision as of 15:01, 22 June 2017

Description

Citrus clementina.jpg
  • A clementine (Citrus × clementina) is a hybrid between a mandarin orange and a sweet orange, so named in 1902.
  • The exterior is a deep orange colour with a smooth, glossy appearance. Clementines can be separated into 7 to 14 segments. Similar to tangerines, they tend to be easy to peel. The clementine is also occasionally referred to as the Moroccan clementine.They are typically juicy and sweet, with less acid than oranges
  • In Citrus clementina, where anther culture was successfully established, previous investigations on the ploidy of 94 plants obtained through anther culture, carried out by flow cytometry analysis, showed that about 82 % of them were tri-haploids, rather than haploids or doubled-haploids, as expected, but embryos with other ploidy levels, such as n, 2n, 4n and 6n, were also obtained (Germanà et al. 2005)[1][2].

Different Genotypes

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18SrRNA[1] 18S ribosomal RNA
  • Diverse cultivars and tissues
FJ356261
  • F:TCGGGTGTTTTCACGTCTCA
  • R:TGGATGCCGCTGGGAAGC
120 58 SYBR
ACTB[1] Beta actin
  • Diverse cultivars and tissues
CB250364
  • F:CCAATTCTCTCTTGAACCTGTCCTT
  • R:GAAGACCGTCAAGAGTAGTCAGT
120 58 SYBR
rpII[1] RNA polymerase II
  • Diverse cultivars and tissues
ET098196
  • F:CACTGCTCTGCTTTCCTTCCAT
  • R:AACTGCCCACTATTCTCGTCTC
120 58 SYBR

Molecular Type

  • mRNA

Evaluation Methods

Contact

  • Name: Ziniu Deng
  • Email: deng7009@163.com
  • Institution: Horticulture and Landscape College, Hunan Agricultural University, Furong District, Changsha 410128, Hunan, China

Citation Statistics

Cited by 78 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Yan J, Yuan F, Long G, et al. Selection of reference genes for quantitative real-time RT-PCR analysis in citrus[J]. Molecular biology reports, 2012, 39(2): 1831-1838.
  2. Cardoso, J.C., Martinelli, A.P., Germanà, M.A. et al.In vitro anther culture of sweet orange (Citrus sinensis L. Osbeck) genotypes and of a C. clementina × C. sinensis ‘Hamlin’ hybrid. Plant Cell Tiss Organ Cult (2014) 117: 455.