Difference between revisions of "Citrus japonica"

From ICG
Jump to navigation Jump to search
Line 2: Line 2:
 
[[File:REFqPCR2014003-1.jpg|right|327px|]]
 
[[File:REFqPCR2014003-1.jpg|right|327px|]]
 
*'''''Citrus''''' belonging to Fortunella, which is a closely related genus to Citrus, has a varying degree of sexual compatibility with Citrus,usually eaten raw as a whole fruit together with the peel, excluding the seeds. Kumquat originated in China and produces edible fruit of various shapes. It is one of the most important fruit crops worldwide, with immense total global production. In addition to its use as fresh food or as a beverage source, citrus products from wild species are valuable for traditional medical and sanitary purposes. Kumquat has been used in traditional herbal medicine, especially for colds and coughs. The juvenile phase of kumquat is significantly shorter than that of other Citrus species, and kumquat can flower several times per year. Kumquats are also an excellent source of nutrients and phytochemicals, including ascorbic acid, carotenoids, flavonoids and essential oils. Some Fortunella plants, such as Fortunella japonica Swingle, Fortunella margarita. Swingle and Fortunella crassifolia Swingle are commonly cultivated in the southern region of China. F. crassifolia, known as jingdan or meiwa kumquat, has a typical citrus character.  <ref name="ref1"/> <ref name="ref2"/>.
 
*'''''Citrus''''' belonging to Fortunella, which is a closely related genus to Citrus, has a varying degree of sexual compatibility with Citrus,usually eaten raw as a whole fruit together with the peel, excluding the seeds. Kumquat originated in China and produces edible fruit of various shapes. It is one of the most important fruit crops worldwide, with immense total global production. In addition to its use as fresh food or as a beverage source, citrus products from wild species are valuable for traditional medical and sanitary purposes. Kumquat has been used in traditional herbal medicine, especially for colds and coughs. The juvenile phase of kumquat is significantly shorter than that of other Citrus species, and kumquat can flower several times per year. Kumquats are also an excellent source of nutrients and phytochemicals, including ascorbic acid, carotenoids, flavonoids and essential oils. Some Fortunella plants, such as Fortunella japonica Swingle, Fortunella margarita. Swingle and Fortunella crassifolia Swingle are commonly cultivated in the southern region of China. F. crassifolia, known as jingdan or meiwa kumquat, has a typical citrus character.  <ref name="ref1"/> <ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Kumquats'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=76966 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Tissues & Abiotic Stress'''''==
 
=='''''Different Tissues & Abiotic Stress'''''==

Revision as of 10:36, 25 June 2017

Description

REFqPCR2014003-1.jpg
  • Citrus belonging to Fortunella, which is a closely related genus to Citrus, has a varying degree of sexual compatibility with Citrus,usually eaten raw as a whole fruit together with the peel, excluding the seeds. Kumquat originated in China and produces edible fruit of various shapes. It is one of the most important fruit crops worldwide, with immense total global production. In addition to its use as fresh food or as a beverage source, citrus products from wild species are valuable for traditional medical and sanitary purposes. Kumquat has been used in traditional herbal medicine, especially for colds and coughs. The juvenile phase of kumquat is significantly shorter than that of other Citrus species, and kumquat can flower several times per year. Kumquats are also an excellent source of nutrients and phytochemicals, including ascorbic acid, carotenoids, flavonoids and essential oils. Some Fortunella plants, such as Fortunella japonica Swingle, Fortunella margarita. Swingle and Fortunella crassifolia Swingle are commonly cultivated in the southern region of China. F. crassifolia, known as jingdan or meiwa kumquat, has a typical citrus character. [1] [2].
  • Common Name: Kumquats
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT7[1] Actin 7
  • Salt & Drought & heavy metal stress
Cs7g29220.3
  • F:CTGGCTTACATCGCTCTTGA
  • R:GCCCATCAGGCAACTCATAG
91 80.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xinhua
  • Email: honest66222@163.com
  • Institution: College of Agriculture, Guangxi University, 100 Daxue Road, Nanning 530004, PR China

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 Hu Y, Chen H, Luo C, et al. (2014) Selection of reference genes for real-time quantitative PCR studies of kumquat in various tissues and under abiotic stress. Scientia Horticulturae 174, 207-216.
  2. Wang YW, Zeng WC, Xu PY, et al. (2012) Chemical Composition and Antimicrobial Activity of the Essential Oil of Kumquat (Fortunella crassifolia Swingle) Peel. International Journal of Molecular Sciences 13, 3382-3393.