Difference between revisions of "Citrus japonica"

From ICG
Jump to navigation Jump to search
(Created page with "==Description== right|327px| * Citrus is one of the most important fruit crops worldwide, with immense total global production (Yun, 1993). In ad...")
 
 
(19 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
−
[[File:REFqPCR2014003-1.jpg|right|327px|]]
+
[[File:Citrus japonica.png|right|200px|link=Citrus japonica]]
−
* Citrus is one of the most important fruit crops worldwide, with immense total global production (Yun, 1993). In addition to its use as fresh food or as a beverage source, citrus products from wild species are valuable for traditional medical and sanitary purposes.
+
*'''''Citrus japonica''''' belongs to Fortunella which is a closely related genus to Citrus. It can flower several times per year, its juvenile phase is significantly shorter than that of other Citrus species. It is originated in China and produces edible fruit of various shapes with immense global production. As one of the most important fruit crops worldwide, Kumquats provide an excellent source of nutrients and phytochemicals, including ascorbic acid, carotenoids, flavonoids and essential oils. Besides, it has also been used in traditional herbal medicine, especially for colds and coughs<ref name="ref1"/><ref name="ref2"/>.
−
* Kumquat belonging to Fortunella, which is a closely related genus to Citrus, has a varying degree of sexual compatibility with Citrus. Kumquat originated in China and produces edible fruit of various shapes. Kumquat has been used in traditional herbal medicine, especially for colds and coughs (http://citrus.hzau.edu.cn/orange/index.php). The juvenile phase of kumquat is significantly shorter than that of other Citrus species, and kumquat can flower several times per year.
+
* <font color=blue>'''Common Name:'''</font> '''Kumquats'''
−
* Kumquats (Fortunella spp.) belong to the Citrus genus are fruit, usually eaten raw as a whole fruit together with the peel, excluding the seeds. The peel is sweet and edible with a typical aroma due to the presence of flavonoids and terpenoids. Kumquats are also an excellent source of nutrients and phytochemicals, including ascorbic acid, carotenoids, flavonoids and essential oils. Some Fortunella plants, such as Fortunella japonica Swingle, Fortunella margarita (Lour.) Swingle and Fortunella crassifolia Swingle are commonly cultivated in the southern region of China. F. crassifolia, known as jingdan or meiwa kumquat, has a typical citrus character.  <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=76966 <font color=blue>'''NCBI Taxonomy'''</font>]
  
−
=='''''Various Tissues & Abiotic Stresses'''''==
+
=='''''Different Tissues & Abiotic Stress'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 13:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 21: Line 21:
 
|align="center"| Actin 7
 
|align="center"| Actin 7
 
|
 
|
−
* Salt & Drought & heavy metal stress  
+
* Salt & drought & heavy metal stress  
 
|align="center"| [http://citrus.hzau.edu.cn/cgi-bin/orange/gene/Cs7g29220.3 '''Cs7g29220.3''']  
 
|align="center"| [http://citrus.hzau.edu.cn/cgi-bin/orange/gene/Cs7g29220.3 '''Cs7g29220.3''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 31: Line 31:
 
|}
 
|}
  
−
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 41: Line 42:
 
*'''Email''': honest66222@163.com
 
*'''Email''': honest66222@163.com
 
*'''Institution''': College of Agriculture, Guangxi University, 100 Daxue Road, Nanning 530004, PR China
 
*'''Institution''': College of Agriculture, Guangxi University, 100 Daxue Road, Nanning 530004, PR China
 +
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=8715984415252067486&as_sdt=2005&sciodt=0,5&hl=en '''9'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
−
Wang YW, Zeng WC, Xu PY, et al. (2012) Chemical Composition and Antimicrobial Activity of the Essential Oil of Kumquat (Fortunella crassifolia Swingle) Peel. International Journal of Molecular Sciences 13, 3382-3393.
+
Hu Y, Chen H, Luo C, et al. (2014) Selection of reference genes for real-time quantitative PCR studies of kumquat in various tissues and under abiotic stress. Scientia Horticulturae 174, 207-216.
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
−
Hu Y, Chen H, Luo C, et al. (2014) Selection of reference genes for real-time quantitative PCR studies of kumquat in various tissues and under abiotic stress. Scientia Horticulturae 174, 207-216.
+
Wang YW, Zeng WC, Xu PY, et al. (2012) Chemical Composition and Antimicrobial Activity of the Essential Oil of Kumquat (Fortunella crassifolia Swingle) Peel. International Journal of Molecular Sciences 13, 3382-3393.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 +
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
 +
[[Category:ACT]][[Category:Drought Treatment]]  [[Category:Salinity Treatment]]  [[Category:Different Tissues]]  [[Category:Abiotic Stress]]  [[Category:Heavy Metals Treatments]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 09:24, 1 September 2017

Description

Citrus japonica.png
  • Citrus japonica belongs to Fortunella which is a closely related genus to Citrus. It can flower several times per year, its juvenile phase is significantly shorter than that of other Citrus species. It is originated in China and produces edible fruit of various shapes with immense global production. As one of the most important fruit crops worldwide, Kumquats provide an excellent source of nutrients and phytochemicals, including ascorbic acid, carotenoids, flavonoids and essential oils. Besides, it has also been used in traditional herbal medicine, especially for colds and coughs[1][2].
  • Common Name: Kumquats
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
ACT7[1] Actin 7
  • Salt & drought & heavy metal stress
 Cs7g29220.3
  • F:CTGGCTTACATCGCTCTTGA
  • R:GCCCATCAGGCAACTCATAG
 91 80.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xinhua
  • Email: honest66222@163.com
  • Institution: College of Agriculture, Guangxi University, 100 Daxue Road, Nanning 530004, PR China

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 Hu Y, Chen H, Luo C, et al. (2014) Selection of reference genes for real-time quantitative PCR studies of kumquat in various tissues and under abiotic stress. Scientia Horticulturae 174, 207-216.
  2. ↑ Wang YW, Zeng WC, Xu PY, et al. (2012) Chemical Composition and Antimicrobial Activity of the Essential Oil of Kumquat (Fortunella crassifolia Swingle) Peel. International Journal of Molecular Sciences 13, 3382-3393.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Citrus_japonica&oldid=8834"