Difference between revisions of "Citrus maxima"

From ICG
Jump to navigation Jump to search
Line 14: Line 14:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]

Revision as of 11:46, 20 June 2017

Description

Citrus maxima.jpg
  • Citrus maxima, the pomelo (also called pummelo or shaddock) in the Rutaceae (citrus family). It is a medium-sized tree but the largest of all Citrus species, with large leaves, flowers, and fruits.
  • The species is native to southern China and Malaysia (and possibly other parts of southeast Asia), and is now cultivated in many tropical and semi-tropical countries for its large fruits. This species was a progenitor of the grapefruit (C. X paradisi) and the tangelo (C.reticulata), among other modern citrus hybrids. Pomelos are often confused with grapefruits, from which they can generally be distinguished by their larger size, thicker rinds, milder—even sweet—flavor, and tough bitter membranes that are often considered inedible.
  • pomelo (Citrus maxima or Citrus grandis), a citrus fruit native to South East Asia with a considerable quantity of peel waste generated in both Thailand and Malaysia – due to the high domestic consumption and export demand, has recently been considered as a potential source of pectin. It is also worth mentioning that the pomelo albedo (spongy white peel) is accounted for approximately 30% of pomelo fruit weight, thus, being a promising source for pectin extraction.[1][2].

Different Genotypes

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18SrRNA[1] 18S ribosomal RNA
  • Diverse cultivars and tissues
FJ356261
  • F:TCGGGTGTTTTCACGTCTCA
  • R:TGGATGCCGCTGGGAAGC
120 58 SYBR
ACTB[1] Beta actin
  • Diverse cultivars and tissues
CB250364
  • F:CCAATTCTCTCTTGAACCTGTCCTT
  • R:GAAGACCGTCAAGAGTAGTCAGT
120 58 SYBR
rpII[1] RNA polymerase II
  • Diverse cultivars and tissues
ET098196
  • F:CACTGCTCTGCTTTCCTTCCAT
  • R:AACTGCCCACTATTCTCGTCTC
120 58 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Ziniu Deng
  • Email: deng7009@163.com
  • Institution: Horticulture and Landscape College, Hunan Agricultural University, Furong District, Changsha 410128, Hunan, China

Citation Statistics

Cited by 78 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Yan J, Yuan F, Long G, et al. Selection of reference genes for quantitative real-time RT-PCR analysis in citrus[J]. Molecular biology reports, 2012, 39(2): 1831-1838.
  2. Pawadee Methacanon, Jaruwan Krongsin, Chaiwut Gamonpilas, Pomelo () pectin: Effects of extraction parameters and its properties, Food Hydrocolloids, Volume 35, 2014, Pages 383-391, ISSN 0268-005X.