Difference between revisions of "Citrus sinensis"

Revision as of 11:46, 20 June 2017

Citrus × sinensis, also known as the Citrus sinensis Sweet Orange Group, includes the commonly cultivated sweet orange, blood oranges, and navel oranges.
The orange fruit is an important agricultural product, used for both the juicy fruit pulp and the aromatic peel (rind). Orange blossoms (the flowers) are used in several different ways, as are the leaves and wood of the tree.
Citrus plants contain large amounts of flavonoids with beneficial effects on human health^[1]^[2].

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
18SrRNA^[1]	18S ribosomal RNA	Diverse cultivars and tissues	FJ356261	F:TCGGGTGTTTTCACGTCTCA R:TGGATGCCGCTGGGAAGC	120	58	SYBR
ACTB^[1]	Beta actin	Diverse cultivars and tissues	CB250364	F:CCAATTCTCTCTTGAACCTGTCCTT R:GAAGACCGTCAAGAGTAGTCAGT	120	58	SYBR
rpII^[1]	RNA polymerase II	Diverse cultivars and tissues	ET098196	F:CACTGCTCTGCTTTCCTTCCAT R:AACTGCCCACTATTCTCGTCTC	120	58	SYBR

Name: Ziniu Deng
Email: deng7009@163.com
Institution: Horticulture and Landscape College, Hunan Agricultural University, Furong District, Changsha 410128, Hunan, China

Cited by 78 (Based on Google Scholar [2017-06-16])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Yan J, Yuan F, Long G, et al. Selection of reference genes for quantitative real-time RT-PCR analysis in citrus[J]. Molecular biology reports, 2012, 39(2): 1831-1838.
↑ Pepe G, Pagano F, Adesso S, Sommella E, Ostacolo C, Manfra M, Chieppa M, Sala M, Russo M, Marzocco S, Campiglia P. Bioavailable Citrus sinensis Extract: Polyphenolic Composition and Biological Activity. Molecules. 2017 Apr 15;22(4).

@@ Line 14: / Line 14: @@
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]