Citrus sinensis

From ICG
Revision as of 11:25, 16 June 2017 by Xysj2012 (talk | contribs) (Created page with "=='''Description'''== =='''''Different Genotypes'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Different Genotypes

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
18SrRNA[1] 18S ribosomal RNA
  • diverse cultivars and tissues
FJ356261
  • F:TCGGGTGTTTTCACGTCTCA
  • R:TGGATGCCGCTGGGAAGC
120 58 SYBR
ACTB[1] Beta actin
  • diverse cultivars and tissues
CB250364
  • F:CCAATTCTCTCTTGAACCTGTCCTT
  • R:GAAGACCGTCAAGAGTAGTCAGT
120 58 SYBR
rpII[1] RNA polymerase II
  • diverse cultivars and tissues
ET098196
  • F:CACTGCTCTGCTTTCCTTCCAT
  • R:AACTGCCCACTATTCTCGTCTC
120 58 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Ziniu Deng
  • Email: deng7009@163.com
  • Institution: Horticulture and Landscape College, Hunan Agricultural University, Furong District, Changsha 410128, Hunan, China

References

  1. 1.0 1.1 1.2 Yan J, Yuan F, Long G, et al. Selection of reference genes for quantitative real-time RT-PCR analysis in citrus[J]. Molecular biology reports, 2012, 39(2): 1831-1838.