Difference between revisions of "Coffea arabica L."
Jump to navigation
Jump to search
Line 185: | Line 185: | ||
| | | | ||
* Total assay | * Total assay | ||
− | * | + | *Genotypes |
*Cold stress | *Cold stress | ||
*Drought stress | *Drought stress | ||
Line 219: | Line 219: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:cagaccagcagaggctgatt | * F:cagaccagcagaggctgatt | ||
− | * R: agaaccaagtgaagggtgga | + | * R:agaaccaagtgaagggtgga |
|align="center"| NA | |align="center"| NA | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 253: | Line 253: | ||
|align="center"| Actin | |align="center"| Actin | ||
| | | | ||
− | *Cold stress | + | *Cold stress |
*Drought stress | *Drought stress | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT000704 '''GT000704'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT000704 '''GT000704'''] |
Revision as of 07:27, 20 June 2017
Contents
Description
- Coffee is an important crop and is crucial to the economy of many developing countries, generating around US$70 billion per year.
- This way, coffee is one of the most valuable international exchange commodities in agricultural trade and coffee farmings are crucial to the economy of many developing countries where its cultivation, processing, transportation and marketing provide employment for millions of people worldwide.
- Abiotic stress is one of the major factors that affect food production worldwide and in tropical countries, drought, salinity, extreme temperatures, nutrient deficiencies and mineral toxicities are among the most important limitants in crop yield.
- It is important to note that, in a scenario of climate changes, these stresses will be increasingly important, associated with land degradation and declining water quality
Salt and Heat Stress
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
EF1[1][2] | Elongation factor 1 |
|
GW484749.1 |
|
NA | 60 | SYBR |
EF1a[1] | Elongation factor 1-alpha |
|
GT708303.1 |
|
NA | 60 | SYBR |
GAPDH[1] | glyceraldehyde-3-phosphate-dehydrogenase |
|
GW488886.1 |
|
NA | 60 | SYBR |
MDH[1] | Malate dehydrogenase |
|
GW464198.1 |
|
NA | 60 | SYBR |
UBQ10[1] | Polyubiquitin 10 |
|
GT697658.1 |
|
NA | 60 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Kenia de Carvalho
- Email: : keniadecarvalho@gmail.com
- Institute: Programa de Po´s-Graduac ¸a ˜o em Agronomia (Produc ¸a ˜o Vegetal),Departamento de Fitotecnia e Fitossanitarismo, Universidade Federal do Parana ´, Curitiba, PR CEP 80035-050, Brazil
Citation Statistics
Cited by 22 (Based on Google Scholar [2017-06-16])
Different Air CO2 Supply & Temperature
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
MDH[2] | Malate Dehydrogenase |
|
GW464198.1 |
|
100 | 60 | SYBR |
ACT [2] | Actin |
|
GT000704 |
|
100 | 60 | SYBR |
S15[2] | 40S ribosomal protein S15 |
|
GR987196 |
|
146 | 60 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
Contact
- Name: José C. Ramalho
- Email: cochichor@isa.ulisboa.pt
- Institution: Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal
Multiple Variables in Coffea spp.
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GAPHD[3] | Glyceraldehyde 3-phosphate dehydrogenase |
|
DV692958 |
|
NA | 60 | SYBR |
Cycl[3] | Cyclophilin |
|
GT007167 |
|
NA | 60 | SYBR |
UBQ10[3] | Ubiquitin |
|
DV686961 |
|
NA | 60 | SYBR |
Ap47[3] | Clathrin adaptor complexes subunit |
|
DV690764 |
|
NA | 60 | SYBR |
EF-1A[3] | Elongation factor 1-alpha |
|
GR996930 |
|
NA | 60 | SYBR |
ACT[3] | Actin |
|
GT000704 |
|
NA | 60 | SYBR |
Apt[3] | Adenine phosphoribosyltransferase |
|
GR996015 |
|
NA | 60 | SYBR |
Moleculer types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: José C. Ramalho
- Email: goulao@iict.pt
- Institute: Centro de Ecofisiologia, Bioquímica e Biotecnologia Vegetal, Instituto de Investigação Científica Tropical I.P. (IICT, IP), Av. da República, Quinta do Marquês, 2784-505 Oeiras, Portugal
References
- ↑ 1.0 1.1 1.2 1.3 1.4 de Carvalho K, Bespalhok Filho J C, Dos Santos T B, et al. Nitrogen starvation, salt and heat stress in coffee (Coffea arabica L.): identification and validation of new genes for qPCR normalization[J]. Molecular biotechnology, 2013, 53(3): 315-325.
- ↑ 2.0 2.1 2.2 2.3 Kenia de CarvalhoJoão Carlos Bespalhok FilhoTiago Benedito dos SantosSilvia Graciele Hülse de SouzaLuiz Gonzaga Esteves VieiraLuis Filipe Protasio PereiraDouglas Silva Domingues. Nitrogen Starvation, Salt and Heat Stress in Coffee (Coffea arabica L.): Identification and Validation of New Genes for qPCR Normalization. Molecular Biotechnology DOI: 10.1007/s12033-012-9529-4.
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 Goulao L F, Fortunato A S, Ramalho J C. Selection of Reference Genes for Normalizing Quantitative Real-Time PCR Gene Expression Data with Multiple Variables in Coffea spp[J]. Plant Molecular Biology Reporter, 2012, 30(3): 741-759.