Difference between revisions of "Coffea arabica L."

From ICG
Jump to navigation Jump to search
Line 294: Line 294:
<ref name="ref2">
<ref name="ref2">
Kenia de CarvalhoJoão Carlos Bespalhok FilhoTiago Benedito dos SantosSilvia Graciele Hülse de SouzaLuiz Gonzaga Esteves VieiraLuis Filipe Protasio PereiraDouglas Silva Domingues. Nitrogen Starvation, Salt and Heat Stress in Coffee (Coffea arabica L.): Identification and Validation of New Genes for qPCR Normalization. Molecular Biotechnology DOI: 10.1007/s12033-012-9529-4.
Kenia de CarvalhoJoão Carlos Bespalhok FilhoTiago Benedito dos SantosSilvia Graciele Hülse de SouzaLuiz Gonzaga Esteves VieiraLuis Filipe Protasio PereiraDouglas Silva Domingues. Nitrogen Starvation, Salt and Heat Stress in Coffee (Coffea arabica L.): Identification and Validation of New Genes for qPCR Normalization. Molecular Biotechnology DOI: 10.1007/s12033-012-9529-4.
<ref name="ref3">
Goulao L F, Fortunato A S, Ramalho J C. Selection of Reference Genes for Normalizing Quantitative Real-Time PCR Gene Expression Data with Multiple Variables in Coffea spp[J]. Plant Molecular Biology Reporter, 2012, 30(3): 741-759.

Revision as of 14:20, 16 June 2017


REFqPCRCoffea arabica L.jpg
  • Coffee is an important crop and is crucial to the economy of many developing countries, generating around US$70 billion per year.
  • This way, coffee is one of the most valuable international exchange commodities in agricultural trade and coffee farmings are crucial to the economy of many developing countries where its cultivation, processing, transportation and marketing provide employment for millions of people worldwide.
  • Abiotic stress is one of the major factors that affect food production worldwide and in tropical countries, drought, salinity, extreme temperatures, nutrient deficiencies and mineral toxicities are among the most important limitants in crop yield.
  • It is important to note that, in a scenario of climate changes, these stresses will be increasingly important, associated with land degradation and declining water quality

Salt and Heat Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
EF1[1][2] Elongation factor 1
  • nitrogen starvation
  • salt
  • heat stress
EF1a[1] Elongation factor 1-alpha
  • nitrogen starvation
  • salt
  • heat stress
GAPDH[1] glyceraldehyde-3-phosphate-dehydrogenase
  • nitrogen starvation
  • salt
  • heat stress
MDH[1] Malate dehydrogenase
  • nitrogen starvation
  • salt
  • heat stress
UBQ10[1] Polyubiquitin 10
  • nitrogen starvation
  • salt
  • heat stress

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Kenia de Carvalho
  • Email: : keniadecarvalho@gmail.com
  • Institute: Programa de Po´s-Graduac ¸a ˜o em Agronomia (Produc ¸a ˜o Vegetal),Departamento de Fitotecnia e Fitossanitarismo, Universidade Federal do Parana ´, Curitiba, PR CEP 80035-050, Brazil

Citation Statistics

Cited by 22 (Based on Google Scholar [2017-06-16])

Different Air CO2 Supply & Temperature

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
MDH[2] Malate Dehydrogenase
  • Univeral reference gene
100 60 SYBR
ACT [2] Actin
  • Univeral reference gene
100 60 SYBR
S15[2] 40S ribosomal protein S15
  • Univeral reference gene
146 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: José C. Ramalho
  • Email: cochichor@isa.ulisboa.pt
  • Institution: Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal

Multiple Variables in Coffea spp

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPHD[3] Glyceraldehyde 3-phosphate dehydrogenase
  • total assay
  • genotype
  • cold stress
  • drought stress
  • multiple stress
  • F:aggctgttgggaaagttcttc
  • R:actgttggaactcggaatgc
Cycl[3] Cyclophilin
  • total assay
  • F:agctctacgcagacacgactcc
  • R:ggtcgatcctttgaagtgcaag
UBQ10[3] Ubiquitin
  • total assay
  • genotype
  • cold stress
  • multiple stress
  • F:cagaccagcagaggctgatt
  • R: agaaccaagtgaagggtgga
Ap47[3] Clathrin adaptor complexes subunit
  • genotype
  • F: ccagattggaggatgctctt
  • R: aaatgcacaagcaacattgg
EF-1A[3] Elongation factor 1-alpha
  • genotype
  • cold stress
  • drought stress
  • multiple stress
  • F: cattgtggtcattggtcatgtc
  • R: acacgcttgtcaattcctcca
ACT[3] Actin
  • cold stress;*drought stress
  • multiple stress
  • F:aagcttgcctatgtggctcttg
  • R:tcacttgtccatctggcaattc
Apt[3] Adenine phosphoribosyltransferase
  • drought stress
  • F: actctccggggctaaaactgtc
  • R:aggtcgtgctggttgagttagg

Moleculer types

  • mRNA

Evaluation Methods


  • Name: José C. Ramalho
  • Email: goulao@iict.pt
  • Institute: Centro de Ecofisiologia, Bioquímica e Biotecnologia Vegetal, Instituto de Investigação Científica Tropical I.P. (IICT, IP), Av. da República, Quinta do Marquês, 2784-505 Oeiras, Portugal


  1. 1.0 1.1 1.2 1.3 1.4 de Carvalho K, Bespalhok Filho J C, Dos Santos T B, et al. Nitrogen starvation, salt and heat stress in coffee (Coffea arabica L.): identification and validation of new genes for qPCR normalization[J]. Molecular biotechnology, 2013, 53(3): 315-325.
  2. 2.0 2.1 2.2 2.3 Kenia de CarvalhoJoão Carlos Bespalhok FilhoTiago Benedito dos SantosSilvia Graciele Hülse de SouzaLuiz Gonzaga Esteves VieiraLuis Filipe Protasio PereiraDouglas Silva Domingues. Nitrogen Starvation, Salt and Heat Stress in Coffee (Coffea arabica L.): Identification and Validation of New Genes for qPCR Normalization. Molecular Biotechnology DOI: 10.1007/s12033-012-9529-4.
  3. 3.0 3.1 3.2 3.3 3.4 3.5 3.6 Cite error: Invalid <ref> tag; no text was provided for refs named ref4

Cite error: <ref> tag with name "ref3" defined in <references> is not used in prior text.