Difference between revisions of "Coffea arabica L."

From ICG
Jump to navigation Jump to search
Line 169: Line 169:
 
*'''Institution''': Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal
 
*'''Institution''': Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''2''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=1587087814594235308&as_sdt=2005&sciodt=0,5&hl=en '''2'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Different Genotypes & Abiotic Stress'''''==
 
=='''''Different Genotypes & Abiotic Stress'''''==

Revision as of 09:35, 1 September 2017

Description

Coffea arabica.png
  • Coffea arabica is a species of Coffea originally indigenous to the forests of the southwestern highlands of Ethiopia. It is an important crop and is crucial to the economy of many developing countries as international exchange commodities in agricultural trade, generating around US$70 billion per year. Its cultivation, processing, transportation and marketing provide employment for millions of people worldwide.
  • Common Name: Coffee
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1[1] Elongation factor 1
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
GW484749.1
  • F:CTGTCCTTGATTGCCACACTTCT
  • R:CTTGGGCTCCTTCTCAAGCTC
NA 60 SYBR
EF1a[1] Elongation factor 1-alpha
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
GT708303.1
  • F:AAGGGAGCTTCCAGCTTTACCT
  • R:TGTGAGAGGTGTGGCAGTCAA
NA 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate-dehydrogenase
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
GW488886.1
  • F:AGGCTGTTGGGAAAGTTCTTC
  • R:ACTGTTGGAACTCGGAATGC
NA 60 SYBR
MDH[1] Malate dehydrogenase
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
GW464198.1
  • F:CCTGATGTCAACCACGCAACT
  • R:GTGGTTATGAACTCTCCATTCAACC
NA 60 SYBR
UBQ10[1] Polyubiquitin 10
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
GT697658.1
  • F:CAGACCAGCAGAGGCTGATT
  • R:AGAACCAAGTGAAGGGTGGA
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Kenia de Carvalho
  • Email: : keniadecarvalho@gmail.com
  • Institution: Programa de Po´s-Graduac ¸a ˜o em Agronomia (Produc ¸a ˜o Vegetal),Departamento de Fitotecnia e Fitossanitarismo, Universidade Federal do Parana ´, Curitiba, PR CEP 80035-050, Brazil

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

Different Air CO2 Supply & Temperature

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
MDH[2] Malate Dehydrogenase
  • Univeral reference gene
GW464198.1
  • F:CCTGATGTCAACCACGCAACT
  • R:GTGGTTATGAACTCTCCATTCAACC
100 60 SYBR
ACT [2] Actin
  • Univeral reference gene
GT000704
  • F:AAGCTTGCCTATGTGGCTCTTG
  • R:TCACTTGTCCATCTGGCAATTC
100 60 SYBR
S15[2] 40S ribosomal protein S15
  • Univeral reference gene
GR987196
  • F:CAATAGGGGCTTGAAGAGG
  • R:TACGCTGCCAATCATCTCAG
146 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: José C. Ramalho
  • Email: cochichor@isa.ulisboa.pt
  • Institution: Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal

Citation Statistics

Cited by 2 (Based on Google Scholar [2017-09-01])

Different Genotypes & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPHD[3] Glyceraldehyde 3-phosphate dehydrogenase
  • Total assay
  • Genotypes
  • Cold stress
  • Drought stress
DV692958
  • F:AGGCTGTTGGGAAAGTTCTTC
  • R:ACTGTTGGAACTCGGAATGC
NA 60 SYBR
Cycl[3] Cyclophilin
  • Total assay
GT007167
  • F:AGCTCTACGCAGACACGACTCC
  • R:GGTCGATCCTTTGAAGTGCAAG
NA 60 SYBR
UBQ10[3] Ubiquitin
  • Total assay
  • Genotype
  • Cold stress
DV686961
  • F:CAGACCAGCAGAGGCTGATT
  • R:AGAACCAAGTGAAGGGTGGA
NA 60 SYBR
Ap47[3] Clathrin adaptor complexes subunit
  • Genotype
DV690764
  • F: CCAGATTGGAGGATGCTCTT
  • R: AAATGCACAAGCAACATTGG
NA 60 SYBR
EF-1A[3] Elongation factor 1-alpha
  • Genotype
  • Cold stress
  • Drought stress
GR996930
  • F: CATTGTGGTCATTGGTCATGTC
  • R: ACACGCTTGTCAATTCCTCCA
NA 60 SYBR
ACT[3] Actin
  • Cold stress
  • Drought stress
GT000704
  • F:AAGCTTGCCTATGTGGCTCTTG
  • R:TCACTTGTCCATCTGGCAATTC
NA 60 SYBR
Apt[3] Adenine phosphoribosyltransferase
  • Drought stress
GR996015
  • F: ACTCTCCGGGGCTAAAACTGTC
  • R:AGGTCGTGCTGGTTGAGTTAGG
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: José C. Ramalho
  • Email: goulao@iict.pt
  • Institution: Centro de Ecofisiologia, Bioquímica e Biotecnologia Vegetal, Instituto de Investigação Científica Tropical I.P. (IICT, IP), Av. da República, Quinta do Marquês, 2784-505 Oeiras, Portugal

Citation Statistics

Cited by 37 (Based on Google Scholar [2017-08-10])

References

  1. 1.0 1.1 1.2 1.3 1.4 de Carvalho K, Bespalhok Filho J C, Dos Santos T B, et al. Nitrogen starvation, salt and heat stress in coffee (Coffea arabica L.): identification and validation of new genes for qPCR normalization[J]. Molecular biotechnology, 2013, 53(3): 315-325.
  2. 2.0 2.1 2.2 Martins M Q, Fortunato A S, Rodrigues W P, et al. Selection and validation of reference genes for accurate RT-qPCR data normalization in Coffea spp. under a climate changes context of interacting elevated [CO2] and temperature[J]. Frontiers in plant science, 2017, 8.
  3. 3.0 3.1 3.2 3.3 3.4 3.5 3.6 Goulao L F, Fortunato A S, Ramalho J C. Selection of Reference Genes for Normalizing Quantitative Real-Time PCR Gene Expression Data with Multiple Variables in Coffea spp[J]. Plant Molecular Biology Reporter, 2012, 30(3): 741-759.

Categories