Difference between revisions of "Coffea arabica L."

From ICG
Jump to navigation Jump to search
(35 intermediate revisions by 8 users not shown)
Line 1: Line 1:
[[File:Coffea arabica.png|right|200px|link=Coffea arabica L.]]
*Coffee is an important crop and is crucial to the economy of many developing countries, generating around US$70 billion per year.  
*'''''Coffea arabica''''' is a species of Coffea originally indigenous to the forests of the southwestern highlands of Ethiopia. It is an important crop and is crucial to the economy of many developing countries as international exchange commodities in agricultural trade, generating around US$70 billion per year. Its cultivation, processing, transportation and marketing provide employment for millions of people worldwide.
*This way, coffee is one of the most valuable international exchange commodities in agricultural trade and coffee farmings are crucial to the economy of many developing countries where its cultivation, processing, transportation and marketing provide employment for millions of people worldwide.  
* <font color=blue>'''Common Name:'''</font> '''Coffee'''
*Abiotic stress is one of the major factors that affect food production worldwide and in tropical countries, drought, salinity, extreme temperatures, nutrient deficiencies and mineral toxicities are among the most important limitants in crop yield.
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=13443 <font color=blue>'''NCBI Taxonomy'''</font>]
*It is important to note that, in a scenario of climate changes, these stresses will be increasingly important, associated with land degradation and declining water quality
=='''''Salt and Heat Stress'''''==
=='''''Abiotic Stress'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
Line 14: Line 13:
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
! Detection
! Detection
|align="center"| EF1<ref name="ref1"/><ref name="ref2"/>
|align="center"| EF1<ref name="ref1"/>
|align="center"| Elongation factor 1
|align="center"| Elongation factor 1
*Nitrogen starvation
*Nitrogen starvation
*Salinity treatment
*Heat stress
*Heat treatment
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GW484749.1 '''GW484749.1''']  
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GW484749.1 '''GW484749.1''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 37: Line 36:
*Nitrogen starvation
*Nitrogen starvation
*Salinity treatment
*Heat stress
*Heat treatment
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GT708303.1 '''GT708303.1''']  
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GT708303.1 '''GT708303.1''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 48: Line 47:
|align="center"| GAPDH<ref name="ref1"/>
|align="center"| GAPDH<ref name="ref1"/>
|align="center"| glyceraldehyde-3-phosphate-dehydrogenase
|align="center"| Glyceraldehyde-3-phosphate-dehydrogenase
*Nitrogen starvation
*Nitrogen starvation
*Salinity treatment
*Heat stress
*Heat treatment
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GW488886.1 '''GW488886.1''']  
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GW488886.1 '''GW488886.1''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 65: Line 64:
*Nitrogen starvation
*Nitrogen starvation
*Salinity treatment
*Heat stress
*Heat treatment
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW464198.1 '''GW464198.1''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW464198.1 '''GW464198.1''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 79: Line 78:
*Nitrogen starvation
*Nitrogen starvation
*Salinity treatment
*Heat stress
*Heat treatment
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GT697658.1 '''GT697658.1''']  
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GT697658.1 '''GT697658.1''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 90: Line 89:
===Moleculer Types===
===Molecular Types===
* mRNA
* mRNA
Line 101: Line 100:
*'''Name''': Kenia de Carvalho
*'''Name''': Kenia de Carvalho
*'''Email''': :  keniadecarvalho@gmail.com
*'''Email''': :  keniadecarvalho@gmail.com
*'''Institute''':  Programa de Po´s-Graduac ¸a ˜o em Agronomia (Produc ¸a ˜o Vegetal),Departamento de Fitotecnia e Fitossanitarismo, Universidade Federal do Parana ´, Curitiba, PR CEP 80035-050, Brazil
*'''Institution''':  Programa de Po´s-Graduac ¸a ˜o em Agronomia (Produc ¸a ˜o Vegetal),Departamento de Fitotecnia e Fitossanitarismo, Universidade Federal do Parana ´, Curitiba, PR CEP 80035-050, Brazil
===Citation Statistics===
===Citation Statistics===
Cited by '''22''' (Based on Google Scholar [2017-06-16])
Cited by [https://scholar.google.com/scholar?cites=3592759687893290730&as_sdt=2005&sciodt=0,5&hl=en '''23'''] (Based on Google Scholar [2017-09-01])
=='''''Different Air CO2 Supply & Temperature'''''==
=='''''Different Air CO2 Supply & Temperature'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
Line 113: Line 113:
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 125: Line 125:
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
|align="center"|  100  
|align="center"|  100  
|align="center"| 60
|align="center"| 60
Line 137: Line 137:
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
|align="center"|  100  
|align="center"|  100  
|align="center"| 60
|align="center"| 60
Line 146: Line 146:
* Univeral reference gene
* Univeral reference gene
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR987196 ''GR987196'']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR987196 '''GR987196''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
|align="center"|  146  
|align="center"|  146  
|align="center"| 60
|align="center"| 60
Line 155: Line 155:
===Moleculer Types===
===Molecular Types===
===Evaluation Methods===  
===Evaluation Methods===  
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 167: Line 168:
*'''Email''': cochichor@isa.ulisboa.pt
*'''Email''': cochichor@isa.ulisboa.pt
*'''Institution''': Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal
*'''Institution''': Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=1587087814594235308&as_sdt=2005&sciodt=0,5&hl=en '''2'''] (Based on Google Scholar [2017-09-01])
=='''Different Genotypes & Abiotic Stress'''==
=='''''Different Genotypes & Abiotic Stress'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
Line 176: Line 179:
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 191: Line 194:
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DV692958 '''DV692958''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DV692958 '''DV692958''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:aggctgttgggaaagttcttc
* R:actgttggaactcggaatgc
|align="center"| NA
|align="center"| NA
|align="center"| 60
|align="center"| 60
Line 203: Line 206:
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT007167 '''GT007167''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT007167 '''GT007167''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:agctctacgcagacacgactcc
* R:ggtcgatcctttgaagtgcaag
|align="center"| NA
|align="center"| NA
|align="center"| 60
|align="center"| 60
Line 218: Line 221:
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DV686961 '''DV686961''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DV686961 '''DV686961''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:cagaccagcagaggctgatt
* R:agaaccaagtgaagggtgga
|align="center"| NA
|align="center"| NA
|align="center"| 60
|align="center"| 60
Line 230: Line 233:
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DV690764 '''DV690764''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DV690764 '''DV690764''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F: ccagattggaggatgctctt
* R: aaatgcacaagcaacattgg
|align="center"| NA
|align="center"| NA
|align="center"| 60
|align="center"| 60
Line 244: Line 247:
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR996930 '''GR996930''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR996930 '''GR996930''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F: cattgtggtcattggtcatgtc
* R: acacgcttgtcaattcctcca
|align="center"| NA
|align="center"| NA
|align="center"| 60
|align="center"| 60
Line 257: Line 260:
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT000704 '''GT000704''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT000704 '''GT000704''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:aagcttgcctatgtggctcttg
* R:tcacttgtccatctggcaattc
|align="center"| NA
|align="center"| NA
|align="center"| 60
|align="center"| 60
Line 269: Line 272:
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR996015 '''GR996015''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR996015 '''GR996015''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F: actctccggggctaaaactgtc
* R:aggtcgtgctggttgagttagg
|align="center"| NA
|align="center"| NA
|align="center"| 60
|align="center"| 60
Line 276: Line 279:
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===
===Evaluation Methods===
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 285: Line 289:
*'''Name''': José C. Ramalho
*'''Name''': José C. Ramalho
*'''Email''': goulao@iict.pt
*'''Email''': goulao@iict.pt
*'''Institute''': Centro de Ecofisiologia, Bioquímica e Biotecnologia Vegetal, Instituto de Investigação Científica Tropical I.P. (IICT, IP), Av. da República, Quinta do Marquês, 2784-505 Oeiras, Portugal
*'''Institution''': Centro de Ecofisiologia, Bioquímica e Biotecnologia Vegetal, Instituto de Investigação Científica Tropical I.P. (IICT, IP), Av. da República, Quinta do Marquês, 2784-505 Oeiras, Portugal
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=17147318173485000408&as_sdt=2005&sciodt=0,5&hl=en '''37'''] (Based on Google Scholar [2017-09-01])
Line 293: Line 299:
<ref name="ref2">
<ref name="ref2">
Kenia de CarvalhoJoão Carlos Bespalhok FilhoTiago Benedito dos SantosSilvia Graciele Hülse de SouzaLuiz Gonzaga Esteves VieiraLuis Filipe Protasio PereiraDouglas Silva Domingues. Nitrogen Starvation, Salt and Heat Stress in Coffee (Coffea arabica L.): Identification and Validation of New Genes for qPCR Normalization. Molecular Biotechnology DOI: 10.1007/s12033-012-9529-4.
Martins M Q, Fortunato A S, Rodrigues W P, et al. Selection and validation of reference genes for accurate RT-qPCR data normalization in Coffea spp. under a climate changes context of interacting elevated [CO2] and temperature[J]. Frontiers in plant science, 2017, 8.
<ref name="ref3">
<ref name="ref3">
Line 299: Line 305:
[[Category:ACT]] [[Category:ACT]] [[Category:AP]] [[Category:APT]] [[Category:Cyclophilin]] [[Category:EF1α]] [[Category:EF1α]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:MDH]] [[Category:MDH]] [[Category:RPS]] [[Category:Ubiquitin]] [[Category:Ubiquitin]]
[[Category:Nitrogen Treatment]]  [[Category:Salinity Treatment]]  [[Category:Abiotic Stress]]  [[Category:Heat Treatment]]  [[Category:Drought Treatment]]  [[Category:Different Air CO2]]  [[Category:Air Temperature]]  [[Category:Different Genotypes]]  [[Category:Cold Treatment]]
[[Category:ACT]] [[Category:ACT]] [[Category:AP]] [[Category:APT]] [[Category:CYC]] [[Category:EF1α]] [[Category:EF1α]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:MDH]] [[Category:MDH]] [[Category:RPS]] [[Category:Ubiquitin]] [[Category:Ubiquitin]]

Latest revision as of 09:36, 1 September 2017


Coffea arabica.png
  • Coffea arabica is a species of Coffea originally indigenous to the forests of the southwestern highlands of Ethiopia. It is an important crop and is crucial to the economy of many developing countries as international exchange commodities in agricultural trade, generating around US$70 billion per year. Its cultivation, processing, transportation and marketing provide employment for millions of people worldwide.
  • Common Name: Coffee
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
EF1[1] Elongation factor 1
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
EF1a[1] Elongation factor 1-alpha
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
GAPDH[1] Glyceraldehyde-3-phosphate-dehydrogenase
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
MDH[1] Malate dehydrogenase
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
UBQ10[1] Polyubiquitin 10
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment

Molecular Types

  • mRNA

Evaluation Methods


  • Name: Kenia de Carvalho
  • Email: : keniadecarvalho@gmail.com
  • Institution: Programa de Po´s-Graduac ¸a ˜o em Agronomia (Produc ¸a ˜o Vegetal),Departamento de Fitotecnia e Fitossanitarismo, Universidade Federal do Parana ´, Curitiba, PR CEP 80035-050, Brazil

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

Different Air CO2 Supply & Temperature

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
MDH[2] Malate Dehydrogenase
  • Univeral reference gene
100 60 SYBR
ACT [2] Actin
  • Univeral reference gene
100 60 SYBR
S15[2] 40S ribosomal protein S15
  • Univeral reference gene
146 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name: José C. Ramalho
  • Email: cochichor@isa.ulisboa.pt
  • Institution: Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal

Citation Statistics

Cited by 2 (Based on Google Scholar [2017-09-01])

Different Genotypes & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
GAPHD[3] Glyceraldehyde 3-phosphate dehydrogenase
  • Total assay
  • Genotypes
  • Cold stress
  • Drought stress
Cycl[3] Cyclophilin
  • Total assay
UBQ10[3] Ubiquitin
  • Total assay
  • Genotype
  • Cold stress
Ap47[3] Clathrin adaptor complexes subunit
  • Genotype
EF-1A[3] Elongation factor 1-alpha
  • Genotype
  • Cold stress
  • Drought stress
ACT[3] Actin
  • Cold stress
  • Drought stress
Apt[3] Adenine phosphoribosyltransferase
  • Drought stress

Molecular Types

  • mRNA

Evaluation Methods


  • Name: José C. Ramalho
  • Email: goulao@iict.pt
  • Institution: Centro de Ecofisiologia, Bioquímica e Biotecnologia Vegetal, Instituto de Investigação Científica Tropical I.P. (IICT, IP), Av. da República, Quinta do Marquês, 2784-505 Oeiras, Portugal

Citation Statistics

Cited by 37 (Based on Google Scholar [2017-09-01])


  1. 1.0 1.1 1.2 1.3 1.4 de Carvalho K, Bespalhok Filho J C, Dos Santos T B, et al. Nitrogen starvation, salt and heat stress in coffee (Coffea arabica L.): identification and validation of new genes for qPCR normalization[J]. Molecular biotechnology, 2013, 53(3): 315-325.
  2. 2.0 2.1 2.2 Martins M Q, Fortunato A S, Rodrigues W P, et al. Selection and validation of reference genes for accurate RT-qPCR data normalization in Coffea spp. under a climate changes context of interacting elevated [CO2] and temperature[J]. Frontiers in plant science, 2017, 8.
  3. 3.0 3.1 3.2 3.3 3.4 3.5 3.6 Goulao L F, Fortunato A S, Ramalho J C. Selection of Reference Genes for Normalizing Quantitative Real-Time PCR Gene Expression Data with Multiple Variables in Coffea spp[J]. Plant Molecular Biology Reporter, 2012, 30(3): 741-759.
