Difference between revisions of "Coffea arabica L."

From ICG
Jump to navigation Jump to search
 
(21 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:REFqPCRCoffea_arabica_L.jpg|right|227px|]]
+
[[File:Coffea arabica.png|right|200px|link=Coffea arabica L.]]
 
*'''''Coffea arabica''''' is a species of Coffea originally indigenous to the forests of the southwestern highlands of Ethiopia. It is an important crop and is crucial to the economy of many developing countries as international exchange commodities in agricultural trade, generating around US$70 billion per year. Its cultivation, processing, transportation and marketing provide employment for millions of people worldwide.
 
*'''''Coffea arabica''''' is a species of Coffea originally indigenous to the forests of the southwestern highlands of Ethiopia. It is an important crop and is crucial to the economy of many developing countries as international exchange commodities in agricultural trade, generating around US$70 billion per year. Its cultivation, processing, transportation and marketing provide employment for millions of people worldwide.
 
* <font color=blue>'''Common Name:'''</font> '''Coffee'''
 
* <font color=blue>'''Common Name:'''</font> '''Coffee'''
Line 6: Line 6:
  
 
=='''''Abiotic Stress'''''==
 
=='''''Abiotic Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 18: Line 18:
 
! Detection
 
! Detection
 
|-
 
|-
|align="center"| EF1<ref name="ref1"/><ref name="ref2"/>
+
|align="center"| EF1<ref name="ref1"/>
 
|align="center"| Elongation factor 1
 
|align="center"| Elongation factor 1
 
|
 
|
Line 103: Line 103:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''22''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=3592759687893290730&as_sdt=2005&sciodt=0,5&hl=en '''23'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Different Air CO2 Supply & Temperature'''''==
 
=='''''Different Air CO2 Supply & Temperature'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 146: Line 146:
 
|
 
|
 
* Univeral reference gene
 
* Univeral reference gene
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR987196 ''GR987196'']  
+
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR987196 '''GR987196''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CAATAGGGGCTTGAAGAGG
 
* F:CAATAGGGGCTTGAAGAGG
Line 155: Line 155:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 167: Line 168:
 
*'''Email''': cochichor@isa.ulisboa.pt
 
*'''Email''': cochichor@isa.ulisboa.pt
 
*'''Institution''': Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal
 
*'''Institution''': Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=1587087814594235308&as_sdt=2005&sciodt=0,5&hl=en '''2'''] (Based on Google Scholar [2017-09-01])
  
=='''Different Genotypes & Abiotic Stress'''==
+
=='''''Different Genotypes & Abiotic Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 276: Line 279:
 
|}
 
|}
  
===Moleculer types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 285: Line 289:
 
*'''Name''': José C. Ramalho
 
*'''Name''': José C. Ramalho
 
*'''Email''': goulao@iict.pt
 
*'''Email''': goulao@iict.pt
*'''Institute''': Centro de Ecofisiologia, Bioquímica e Biotecnologia Vegetal, Instituto de Investigação Científica Tropical I.P. (IICT, IP), Av. da República, Quinta do Marquês, 2784-505 Oeiras, Portugal
+
*'''Institution''': Centro de Ecofisiologia, Bioquímica e Biotecnologia Vegetal, Instituto de Investigação Científica Tropical I.P. (IICT, IP), Av. da República, Quinta do Marquês, 2784-505 Oeiras, Portugal
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=17147318173485000408&as_sdt=2005&sciodt=0,5&hl=en '''37'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 293: Line 299:
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
Kenia de CarvalhoJoão Carlos Bespalhok FilhoTiago Benedito dos SantosSilvia Graciele Hülse de SouzaLuiz Gonzaga Esteves VieiraLuis Filipe Protasio PereiraDouglas Silva Domingues. Nitrogen Starvation, Salt and Heat Stress in Coffee (Coffea arabica L.): Identification and Validation of New Genes for qPCR Normalization. Molecular Biotechnology DOI: 10.1007/s12033-012-9529-4.
+
Martins M Q, Fortunato A S, Rodrigues W P, et al. Selection and validation of reference genes for accurate RT-qPCR data normalization in Coffea spp. under a climate changes context of interacting elevated [CO2] and temperature[J]. Frontiers in plant science, 2017, 8.
 
</ref>
 
</ref>
 
<ref name="ref3">
 
<ref name="ref3">
Line 299: Line 305:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Plants]]
 
[[Category:Plants]]
[[Category:mRNA]] 
+
[[Category:mRNA]][[Category:SYBR]]
[[Category:SYBR]]
+
[[Category:ACT]] [[Category:ACT]] [[Category:AP]] [[Category:APT]] [[Category:Cyclophilin]] [[Category:EF1α]] [[Category:EF1α]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:MDH]] [[Category:MDH]] [[Category:RPS]] [[Category:Ubiquitin]] [[Category:Ubiquitin]]
[[Category:ACT]] [[Category:ACT]] [[Category:AP]] [[Category:APT]] [[Category:CYC]] [[Category:EF1α]] [[Category:EF1α]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:MDH]] [[Category:MDH]] [[Category:RPS]] [[Category:Ubiquitin]] [[Category:Ubiquitin]]
 
 
[[Category:Nitrogen Treatment]]  [[Category:Salinity Treatment]]  [[Category:Abiotic Stress]]  [[Category:Heat Treatment]]  [[Category:Drought Treatment]]  [[Category:Different Air CO2]]  [[Category:Air Temperature]]  [[Category:Different Genotypes]]  [[Category:Cold Treatment]]
 
[[Category:Nitrogen Treatment]]  [[Category:Salinity Treatment]]  [[Category:Abiotic Stress]]  [[Category:Heat Treatment]]  [[Category:Drought Treatment]]  [[Category:Different Air CO2]]  [[Category:Air Temperature]]  [[Category:Different Genotypes]]  [[Category:Cold Treatment]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:RefFinder]]

Latest revision as of 09:36, 1 September 2017

Description

Coffea arabica.png
  • Coffea arabica is a species of Coffea originally indigenous to the forests of the southwestern highlands of Ethiopia. It is an important crop and is crucial to the economy of many developing countries as international exchange commodities in agricultural trade, generating around US$70 billion per year. Its cultivation, processing, transportation and marketing provide employment for millions of people worldwide.
  • Common Name: Coffee
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1[1] Elongation factor 1
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
GW484749.1
  • F:CTGTCCTTGATTGCCACACTTCT
  • R:CTTGGGCTCCTTCTCAAGCTC
NA 60 SYBR
EF1a[1] Elongation factor 1-alpha
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
GT708303.1
  • F:AAGGGAGCTTCCAGCTTTACCT
  • R:TGTGAGAGGTGTGGCAGTCAA
NA 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate-dehydrogenase
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
GW488886.1
  • F:AGGCTGTTGGGAAAGTTCTTC
  • R:ACTGTTGGAACTCGGAATGC
NA 60 SYBR
MDH[1] Malate dehydrogenase
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
GW464198.1
  • F:CCTGATGTCAACCACGCAACT
  • R:GTGGTTATGAACTCTCCATTCAACC
NA 60 SYBR
UBQ10[1] Polyubiquitin 10
  • Nitrogen starvation
  • Salinity treatment
  • Heat treatment
GT697658.1
  • F:CAGACCAGCAGAGGCTGATT
  • R:AGAACCAAGTGAAGGGTGGA
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Kenia de Carvalho
  • Email: : keniadecarvalho@gmail.com
  • Institution: Programa de Po´s-Graduac ¸a ˜o em Agronomia (Produc ¸a ˜o Vegetal),Departamento de Fitotecnia e Fitossanitarismo, Universidade Federal do Parana ´, Curitiba, PR CEP 80035-050, Brazil

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

Different Air CO2 Supply & Temperature

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
MDH[2] Malate Dehydrogenase
  • Univeral reference gene
GW464198.1
  • F:CCTGATGTCAACCACGCAACT
  • R:GTGGTTATGAACTCTCCATTCAACC
100 60 SYBR
ACT [2] Actin
  • Univeral reference gene
GT000704
  • F:AAGCTTGCCTATGTGGCTCTTG
  • R:TCACTTGTCCATCTGGCAATTC
100 60 SYBR
S15[2] 40S ribosomal protein S15
  • Univeral reference gene
GR987196
  • F:CAATAGGGGCTTGAAGAGG
  • R:TACGCTGCCAATCATCTCAG
146 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: José C. Ramalho
  • Email: cochichor@isa.ulisboa.pt
  • Institution: Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal

Citation Statistics

Cited by 2 (Based on Google Scholar [2017-09-01])

Different Genotypes & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPHD[3] Glyceraldehyde 3-phosphate dehydrogenase
  • Total assay
  • Genotypes
  • Cold stress
  • Drought stress
DV692958
  • F:AGGCTGTTGGGAAAGTTCTTC
  • R:ACTGTTGGAACTCGGAATGC
NA 60 SYBR
Cycl[3] Cyclophilin
  • Total assay
GT007167
  • F:AGCTCTACGCAGACACGACTCC
  • R:GGTCGATCCTTTGAAGTGCAAG
NA 60 SYBR
UBQ10[3] Ubiquitin
  • Total assay
  • Genotype
  • Cold stress
DV686961
  • F:CAGACCAGCAGAGGCTGATT
  • R:AGAACCAAGTGAAGGGTGGA
NA 60 SYBR
Ap47[3] Clathrin adaptor complexes subunit
  • Genotype
DV690764
  • F: CCAGATTGGAGGATGCTCTT
  • R: AAATGCACAAGCAACATTGG
NA 60 SYBR
EF-1A[3] Elongation factor 1-alpha
  • Genotype
  • Cold stress
  • Drought stress
GR996930
  • F: CATTGTGGTCATTGGTCATGTC
  • R: ACACGCTTGTCAATTCCTCCA
NA 60 SYBR
ACT[3] Actin
  • Cold stress
  • Drought stress
GT000704
  • F:AAGCTTGCCTATGTGGCTCTTG
  • R:TCACTTGTCCATCTGGCAATTC
NA 60 SYBR
Apt[3] Adenine phosphoribosyltransferase
  • Drought stress
GR996015
  • F: ACTCTCCGGGGCTAAAACTGTC
  • R:AGGTCGTGCTGGTTGAGTTAGG
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: José C. Ramalho
  • Email: goulao@iict.pt
  • Institution: Centro de Ecofisiologia, Bioquímica e Biotecnologia Vegetal, Instituto de Investigação Científica Tropical I.P. (IICT, IP), Av. da República, Quinta do Marquês, 2784-505 Oeiras, Portugal

Citation Statistics

Cited by 37 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 de Carvalho K, Bespalhok Filho J C, Dos Santos T B, et al. Nitrogen starvation, salt and heat stress in coffee (Coffea arabica L.): identification and validation of new genes for qPCR normalization[J]. Molecular biotechnology, 2013, 53(3): 315-325.
  2. 2.0 2.1 2.2 Martins M Q, Fortunato A S, Rodrigues W P, et al. Selection and validation of reference genes for accurate RT-qPCR data normalization in Coffea spp. under a climate changes context of interacting elevated [CO2] and temperature[J]. Frontiers in plant science, 2017, 8.
  3. 3.0 3.1 3.2 3.3 3.4 3.5 3.6 Goulao L F, Fortunato A S, Ramalho J C. Selection of Reference Genes for Normalizing Quantitative Real-Time PCR Gene Expression Data with Multiple Variables in Coffea spp[J]. Plant Molecular Biology Reporter, 2012, 30(3): 741-759.

Categories