Difference between revisions of "Coffea arabica L."
Jump to navigation
Jump to search
Wangzhennan (talk | contribs) |
|||
(43 intermediate revisions by 8 users not shown) | |||
Line 1: | Line 1: | ||
=='''Description'''== | =='''Description'''== | ||
− | [[File: | + | [[File:Coffea arabica.png|right|200px|link=Coffea arabica L.]] |
− | * | + | *'''''Coffea arabica''''' is a species of Coffea originally indigenous to the forests of the southwestern highlands of Ethiopia. It is an important crop and is crucial to the economy of many developing countries as international exchange commodities in agricultural trade, generating around US$70 billion per year. Its cultivation, processing, transportation and marketing provide employment for millions of people worldwide. |
− | + | * <font color=blue>'''Common Name:'''</font> '''Coffee''' | |
− | * | + | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=13443 <font color=blue>'''NCBI Taxonomy'''</font>] |
− | * | ||
− | ==''''' | + | =='''''Abiotic Stress'''''== |
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 14: | Line 13: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
! Detection | ! Detection | ||
|- | |- | ||
− | |align="center"| EF1<ref name="ref1 | + | |align="center"| EF1<ref name="ref1"/> |
|align="center"| Elongation factor 1 | |align="center"| Elongation factor 1 | ||
| | | | ||
− | * | + | *Nitrogen starvation |
− | * | + | *Salinity treatment |
− | * | + | *Heat treatment |
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW484749.1 '''GW484749.1'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW484749.1 '''GW484749.1'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 36: | Line 35: | ||
|align="center"| Elongation factor 1-alpha | |align="center"| Elongation factor 1-alpha | ||
| | | | ||
− | * | + | *Nitrogen starvation |
− | * | + | *Salinity treatment |
− | * | + | *Heat treatment |
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT708303.1 '''GT708303.1'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT708303.1 '''GT708303.1'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 48: | Line 47: | ||
|- | |- | ||
|align="center"| GAPDH<ref name="ref1"/> | |align="center"| GAPDH<ref name="ref1"/> | ||
− | |align="center"| | + | |align="center"| Glyceraldehyde-3-phosphate-dehydrogenase |
| | | | ||
− | * | + | *Nitrogen starvation |
− | * | + | *Salinity treatment |
− | * | + | *Heat treatment |
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW488886.1 '''GW488886.1'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW488886.1 '''GW488886.1'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 64: | Line 63: | ||
|align="center"| Malate dehydrogenase | |align="center"| Malate dehydrogenase | ||
| | | | ||
− | * | + | *Nitrogen starvation |
− | * | + | *Salinity treatment |
− | * | + | *Heat treatment |
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW464198.1 '''GW464198.1'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW464198.1 '''GW464198.1'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 78: | Line 77: | ||
|align="center"| Polyubiquitin 10 | |align="center"| Polyubiquitin 10 | ||
| | | | ||
− | * | + | *Nitrogen starvation |
− | * | + | *Salinity treatment |
− | * | + | *Heat treatment |
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT697658.1 '''GT697658.1'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT697658.1 '''GT697658.1'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 90: | Line 89: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
* mRNA | * mRNA | ||
Line 101: | Line 100: | ||
*'''Name''': Kenia de Carvalho | *'''Name''': Kenia de Carvalho | ||
*'''Email''': : keniadecarvalho@gmail.com | *'''Email''': : keniadecarvalho@gmail.com | ||
− | *''' | + | *'''Institution''': Programa de Po´s-Graduac ¸a ˜o em Agronomia (Produc ¸a ˜o Vegetal),Departamento de Fitotecnia e Fitossanitarismo, Universidade Federal do Parana ´, Curitiba, PR CEP 80035-050, Brazil |
+ | |||
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=3592759687893290730&as_sdt=2005&sciodt=0,5&hl=en '''23'''] (Based on Google Scholar [2017-09-01]) |
=='''''Different Air CO2 Supply & Temperature'''''== | =='''''Different Air CO2 Supply & Temperature'''''== | ||
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 113: | Line 113: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 125: | Line 125: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:CCTGATGTCAACCACGCAACT | * F:CCTGATGTCAACCACGCAACT | ||
− | * R: | + | * R:GTGGTTATGAACTCTCCATTCAACC |
|align="center"| 100 | |align="center"| 100 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 137: | Line 137: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:AAGCTTGCCTATGTGGCTCTTG | * F:AAGCTTGCCTATGTGGCTCTTG | ||
− | * R: | + | * R:TCACTTGTCCATCTGGCAATTC |
|align="center"| 100 | |align="center"| 100 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 146: | Line 146: | ||
| | | | ||
* Univeral reference gene | * Univeral reference gene | ||
− | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR987196 ''GR987196''] | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR987196 '''GR987196'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:CAATAGGGGCTTGAAGAGG | * F:CAATAGGGGCTTGAAGAGG | ||
− | * R: | + | * R:TACGCTGCCAATCATCTCAG |
|align="center"| 146 | |align="center"| 146 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 155: | Line 155: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
*mRNA | *mRNA | ||
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 167: | Line 168: | ||
*'''Email''': cochichor@isa.ulisboa.pt | *'''Email''': cochichor@isa.ulisboa.pt | ||
*'''Institution''': Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal | *'''Institution''': Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal | ||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=1587087814594235308&as_sdt=2005&sciodt=0,5&hl=en '''2'''] (Based on Google Scholar [2017-09-01]) | ||
− | ==''' | + | =='''''Different Genotypes & Abiotic Stress'''''== |
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 176: | Line 179: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 184: | Line 187: | ||
|align="center"| Glyceraldehyde 3-phosphate dehydrogenase | |align="center"| Glyceraldehyde 3-phosphate dehydrogenase | ||
| | | | ||
− | * | + | * Total assay |
− | * | + | *Genotypes |
− | * | + | *Cold stress |
− | * | + | *Drought stress |
− | + | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DV692958 '''DV692958'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DV692958 '''DV692958'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
− | * F: | + | * F:AGGCTGTTGGGAAAGTTCTTC |
− | * R: | + | * R:ACTGTTGGAACTCGGAATGC |
|align="center"| NA | |align="center"| NA | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 200: | Line 203: | ||
|align="center"| Cyclophilin | |align="center"| Cyclophilin | ||
| | | | ||
− | * | + | * Total assay |
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT007167 '''GT007167'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT007167 '''GT007167'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
− | * F: | + | * F:AGCTCTACGCAGACACGACTCC |
− | * R: | + | * R:GGTCGATCCTTTGAAGTGCAAG |
|align="center"| NA | |align="center"| NA | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 212: | Line 215: | ||
|align="center"| Ubiquitin | |align="center"| Ubiquitin | ||
| | | | ||
− | * | + | * Total assay |
− | * | + | *Genotype |
− | * | + | *Cold stress |
− | + | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DV686961 '''DV686961'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DV686961 '''DV686961'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
− | * F: | + | * F:CAGACCAGCAGAGGCTGATT |
− | * R: | + | * R:AGAACCAAGTGAAGGGTGGA |
|align="center"| NA | |align="center"| NA | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 227: | Line 230: | ||
|align="center"| Clathrin adaptor complexes subunit | |align="center"| Clathrin adaptor complexes subunit | ||
| | | | ||
− | * | + | *Genotype |
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DV690764 '''DV690764'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DV690764 '''DV690764'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
− | * F: | + | * F: CCAGATTGGAGGATGCTCTT |
− | * R: | + | * R: AAATGCACAAGCAACATTGG |
|align="center"| NA | |align="center"| NA | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 239: | Line 242: | ||
|align="center"| Elongation factor 1-alpha | |align="center"| Elongation factor 1-alpha | ||
| | | | ||
− | * | + | *Genotype |
− | * | + | *Cold stress |
− | * | + | *Drought stress |
− | |||
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR996930 '''GR996930'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR996930 '''GR996930'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
− | * F: | + | * F: CATTGTGGTCATTGGTCATGTC |
− | * R: | + | * R: ACACGCTTGTCAATTCCTCCA |
|align="center"| NA | |align="center"| NA | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 254: | Line 256: | ||
|align="center"| Actin | |align="center"| Actin | ||
| | | | ||
− | * | + | *Cold stress |
− | * | + | *Drought stress |
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT000704 '''GT000704'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GT000704 '''GT000704'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
− | * F: | + | * F:AAGCTTGCCTATGTGGCTCTTG |
− | * R: | + | * R:TCACTTGTCCATCTGGCAATTC |
|align="center"| NA | |align="center"| NA | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 267: | Line 269: | ||
|align="center"| Adenine phosphoribosyltransferase | |align="center"| Adenine phosphoribosyltransferase | ||
| | | | ||
− | * | + | *Drought stress |
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR996015 '''GR996015'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GR996015 '''GR996015'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
− | * F: | + | * F: ACTCTCCGGGGCTAAAACTGTC |
− | * R: | + | * R:AGGTCGTGCTGGTTGAGTTAGG |
|align="center"| NA | |align="center"| NA | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 277: | Line 279: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
* mRNA | * mRNA | ||
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 286: | Line 289: | ||
*'''Name''': José C. Ramalho | *'''Name''': José C. Ramalho | ||
*'''Email''': goulao@iict.pt | *'''Email''': goulao@iict.pt | ||
− | *''' | + | *'''Institution''': Centro de Ecofisiologia, Bioquímica e Biotecnologia Vegetal, Instituto de Investigação Científica Tropical I.P. (IICT, IP), Av. da República, Quinta do Marquês, 2784-505 Oeiras, Portugal |
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=17147318173485000408&as_sdt=2005&sciodt=0,5&hl=en '''37'''] (Based on Google Scholar [2017-09-01]) | ||
=='''References'''== | =='''References'''== | ||
Line 294: | Line 299: | ||
</ref> | </ref> | ||
<ref name="ref2"> | <ref name="ref2"> | ||
− | + | Martins M Q, Fortunato A S, Rodrigues W P, et al. Selection and validation of reference genes for accurate RT-qPCR data normalization in Coffea spp. under a climate changes context of interacting elevated [CO2] and temperature[J]. Frontiers in plant science, 2017, 8. | |
</ref> | </ref> | ||
<ref name="ref3"> | <ref name="ref3"> | ||
Line 300: | Line 305: | ||
</ref> | </ref> | ||
</references> | </references> | ||
+ | =='''Categories'''== | ||
+ | [[Category:Plants]] | ||
+ | [[Category:mRNA]][[Category:SYBR]] | ||
+ | [[Category:ACT]] [[Category:ACT]] [[Category:AP]] [[Category:APT]] [[Category:Cyclophilin]] [[Category:EF1α]] [[Category:EF1α]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:MDH]] [[Category:MDH]] [[Category:RPS]] [[Category:Ubiquitin]] [[Category:Ubiquitin]] | ||
+ | [[Category:Nitrogen Treatment]] [[Category:Salinity Treatment]] [[Category:Abiotic Stress]] [[Category:Heat Treatment]] [[Category:Drought Treatment]] [[Category:Different Air CO2]] [[Category:Air Temperature]] [[Category:Different Genotypes]] [[Category:Cold Treatment]] | ||
− | [[Category: | + | [[Category:geNorm]] |
+ | [[Category:NormFinder]] | ||
+ | [[Category:BestKeeper]] | ||
+ | [[Category:RefFinder]] |
Latest revision as of 09:36, 1 September 2017
Contents
Description
- Coffea arabica is a species of Coffea originally indigenous to the forests of the southwestern highlands of Ethiopia. It is an important crop and is crucial to the economy of many developing countries as international exchange commodities in agricultural trade, generating around US$70 billion per year. Its cultivation, processing, transportation and marketing provide employment for millions of people worldwide.
- Common Name: Coffee
- NCBI Taxonomy
Abiotic Stress
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
EF1[1] | Elongation factor 1 |
|
GW484749.1 |
|
NA | 60 | SYBR |
EF1a[1] | Elongation factor 1-alpha |
|
GT708303.1 |
|
NA | 60 | SYBR |
GAPDH[1] | Glyceraldehyde-3-phosphate-dehydrogenase |
|
GW488886.1 |
|
NA | 60 | SYBR |
MDH[1] | Malate dehydrogenase |
|
GW464198.1 |
|
NA | 60 | SYBR |
UBQ10[1] | Polyubiquitin 10 |
|
GT697658.1 |
|
NA | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Kenia de Carvalho
- Email: : keniadecarvalho@gmail.com
- Institution: Programa de Po´s-Graduac ¸a ˜o em Agronomia (Produc ¸a ˜o Vegetal),Departamento de Fitotecnia e Fitossanitarismo, Universidade Federal do Parana ´, Curitiba, PR CEP 80035-050, Brazil
Citation Statistics
Cited by 23 (Based on Google Scholar [2017-09-01])
Different Air CO2 Supply & Temperature
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
MDH[2] | Malate Dehydrogenase |
|
GW464198.1 |
|
100 | 60 | SYBR |
ACT [2] | Actin |
|
GT000704 |
|
100 | 60 | SYBR |
S15[2] | 40S ribosomal protein S15 |
|
GR987196 |
|
146 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
Contact
- Name: José C. Ramalho
- Email: cochichor@isa.ulisboa.pt
- Institution: Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal
Citation Statistics
Cited by 2 (Based on Google Scholar [2017-09-01])
Different Genotypes & Abiotic Stress
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GAPHD[3] | Glyceraldehyde 3-phosphate dehydrogenase |
|
DV692958 |
|
NA | 60 | SYBR |
Cycl[3] | Cyclophilin |
|
GT007167 |
|
NA | 60 | SYBR |
UBQ10[3] | Ubiquitin |
|
DV686961 |
|
NA | 60 | SYBR |
Ap47[3] | Clathrin adaptor complexes subunit |
|
DV690764 |
|
NA | 60 | SYBR |
EF-1A[3] | Elongation factor 1-alpha |
|
GR996930 |
|
NA | 60 | SYBR |
ACT[3] | Actin |
|
GT000704 |
|
NA | 60 | SYBR |
Apt[3] | Adenine phosphoribosyltransferase |
|
GR996015 |
|
NA | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: José C. Ramalho
- Email: goulao@iict.pt
- Institution: Centro de Ecofisiologia, Bioquímica e Biotecnologia Vegetal, Instituto de Investigação Científica Tropical I.P. (IICT, IP), Av. da República, Quinta do Marquês, 2784-505 Oeiras, Portugal
Citation Statistics
Cited by 37 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 1.4 de Carvalho K, Bespalhok Filho J C, Dos Santos T B, et al. Nitrogen starvation, salt and heat stress in coffee (Coffea arabica L.): identification and validation of new genes for qPCR normalization[J]. Molecular biotechnology, 2013, 53(3): 315-325.
- ↑ 2.0 2.1 2.2 Martins M Q, Fortunato A S, Rodrigues W P, et al. Selection and validation of reference genes for accurate RT-qPCR data normalization in Coffea spp. under a climate changes context of interacting elevated [CO2] and temperature[J]. Frontiers in plant science, 2017, 8.
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 Goulao L F, Fortunato A S, Ramalho J C. Selection of Reference Genes for Normalizing Quantitative Real-Time PCR Gene Expression Data with Multiple Variables in Coffea spp[J]. Plant Molecular Biology Reporter, 2012, 30(3): 741-759.