Difference between revisions of "Coffea arabica L."
Jump to navigation
Jump to search
Line 147: | Line 147: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:CAATAGGGGCTTGAAGAGG | * F:CAATAGGGGCTTGAAGAGG | ||
− | * R: | + | * R:TACGCTGCCAATCATCTCAG |
|align="center"| 146 | |align="center"| 146 | ||
|align="center"| 60 | |align="center"| 60 |
Revision as of 01:26, 23 June 2017
Contents
Description
- Coffea arabica is a species of Coffea originally indigenous to the forests of the southwestern highlands of Ethiopia. It is an important crop and is crucial to the economy of many developing countries as international exchange commodities in agricultural trade, generating around US$70 billion per year. Its cultivation, processing, transportation and marketing provide employment for millions of people worldwide.
Abiotic Stress
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
EF1[1][2] | Elongation factor 1 |
|
GW484749.1 |
|
NA | 60 | SYBR |
EF1a[1] | Elongation factor 1-alpha |
|
GT708303.1 |
|
NA | 60 | SYBR |
GAPDH[1] | Glyceraldehyde-3-phosphate-dehydrogenase |
|
GW488886.1 |
|
NA | 60 | SYBR |
MDH[1] | Malate dehydrogenase |
|
GW464198.1 |
|
NA | 60 | SYBR |
UBQ10[1] | Polyubiquitin 10 |
|
GT697658.1 |
|
NA | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Kenia de Carvalho
- Email: : keniadecarvalho@gmail.com
- Institution: Programa de Po´s-Graduac ¸a ˜o em Agronomia (Produc ¸a ˜o Vegetal),Departamento de Fitotecnia e Fitossanitarismo, Universidade Federal do Parana ´, Curitiba, PR CEP 80035-050, Brazil
Citation Statistics
Cited by 22 (Based on Google Scholar [2017-06-16])
Different Air CO2 Supply & Temperature
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
MDH[2] | Malate Dehydrogenase |
|
GW464198.1 |
|
100 | 60 | SYBR |
ACT [2] | Actin |
|
GT000704 |
|
100 | 60 | SYBR |
S15[2] | 40S ribosomal protein S15 |
|
GR987196 |
|
146 | 60 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
Contact
- Name: José C. Ramalho
- Email: cochichor@isa.ulisboa.pt
- Institution: Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal
Different Genotypes & Abiotic Stress
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GAPHD[3] | Glyceraldehyde 3-phosphate dehydrogenase |
|
DV692958 |
|
NA | 60 | SYBR |
Cycl[3] | Cyclophilin |
|
GT007167 |
|
NA | 60 | SYBR |
UBQ10[3] | Ubiquitin |
|
DV686961 |
|
NA | 60 | SYBR |
Ap47[3] | Clathrin adaptor complexes subunit |
|
DV690764 |
|
NA | 60 | SYBR |
EF-1A[3] | Elongation factor 1-alpha |
|
GR996930 |
|
NA | 60 | SYBR |
ACT[3] | Actin |
|
GT000704 |
|
NA | 60 | SYBR |
Apt[3] | Adenine phosphoribosyltransferase |
|
GR996015 |
|
NA | 60 | SYBR |
Moleculer types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: José C. Ramalho
- Email: goulao@iict.pt
- Institute: Centro de Ecofisiologia, Bioquímica e Biotecnologia Vegetal, Instituto de Investigação Científica Tropical I.P. (IICT, IP), Av. da República, Quinta do Marquês, 2784-505 Oeiras, Portugal
References
- ↑ 1.0 1.1 1.2 1.3 1.4 de Carvalho K, Bespalhok Filho J C, Dos Santos T B, et al. Nitrogen starvation, salt and heat stress in coffee (Coffea arabica L.): identification and validation of new genes for qPCR normalization[J]. Molecular biotechnology, 2013, 53(3): 315-325.
- ↑ 2.0 2.1 2.2 2.3 Kenia de CarvalhoJoão Carlos Bespalhok FilhoTiago Benedito dos SantosSilvia Graciele Hülse de SouzaLuiz Gonzaga Esteves VieiraLuis Filipe Protasio PereiraDouglas Silva Domingues. Nitrogen Starvation, Salt and Heat Stress in Coffee (Coffea arabica L.): Identification and Validation of New Genes for qPCR Normalization. Molecular Biotechnology DOI: 10.1007/s12033-012-9529-4.
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 Goulao L F, Fortunato A S, Ramalho J C. Selection of Reference Genes for Normalizing Quantitative Real-Time PCR Gene Expression Data with Multiple Variables in Coffea spp[J]. Plant Molecular Biology Reporter, 2012, 30(3): 741-759.