Coffea arabica L.

From ICG
Revision as of 12:49, 15 June 2017 by ICG Expert1 (talk | contribs) (Created page with "=='''Description'''== =='''''Salt and Heat Stress'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene symbol ! Gene name...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Salt and Heat Stress

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
EF1[1] Elongation factor 1
  • nitrogen starvation
  • salt
  • heat stress
GW484749.1
  • F:CTGTCCTTGATTGCCACACTTCT
  • R:CTTGGGCTCCTTCTCAAGCTC
NA 60 SYBR
EF1a[1] Elongation factor 1-alpha
  • nitrogen starvation
  • salt
  • heat stress
GT708303.1
  • F:AAGGGAGCTTCCAGCTTTACCT
  • R:TGTGAGAGGTGTGGCAGTCAA
NA 60 SYBR
GAPDH[1] glyceraldehyde-3-phosphate-dehydrogenase
  • nitrogen starvation
  • salt
  • heat stress
GW488886.1
  • F:AGGCTGTTGGGAAAGTTCTTC
  • R:ACTGTTGGAACTCGGAATGC
NA 60 SYBR
MDH[1] Malate dehydrogenase
  • nitrogen starvation
  • salt
  • heat stress
GW464198.1
  • F:CCTGATGTCAACCACGCAACT
  • R:GTGGTTATGAACTCTCCATTCAACC
NA 60 SYBR
UBQ10[1] Polyubiquitin 10
  • nitrogen starvation
  • salt
  • heat stress
GT697658.1
  • F:CAGACCAGCAGAGGCTGATT
  • R:AGAACCAAGTGAAGGGTGGA
NA 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Kenia de Carvalho
  • Email: : keniadecarvalho@gmail.com
  • Institute: Programa de Po´s-Graduac ¸a ˜o em Agronomia (Produc ¸a ˜o Vegetal),Departamento de Fitotecnia e Fitossanitarismo, Universidade Federal do Parana ´, Curitiba, PR CEP 80035-050, Brazil

Different Air CO2 Supply & Temperature

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
MDH[2] Malate Dehydrogenase
  • Univeral reference gene
GW464198.1
  • F:CCTGATGTCAACCACGCAACT
  • R:CCTGATGTCAACCACGCAACT
100 60 SYBR
ACT [2] Actin
  • Univeral reference gene
GT000704
  • F:AAGCTTGCCTATGTGGCTCTTG
  • R:AAGCTTGCCTATGTGGCTCTTG
100 60 SYBR
S15[2] 40S ribosomal protein S15
  • Univeral reference gene
GR987196
  • F:CAATAGGGGCTTGAAGAGG
  • R:CAATAGGGGCTTGAAGAGG
146 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: José C. Ramalho
  • Email: cochichor@isa.ulisboa.pt
  • Institution: Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal

References

  1. 1.0 1.1 1.2 1.3 1.4 de Carvalho K, Bespalhok Filho J C, Dos Santos T B, et al. Nitrogen starvation, salt and heat stress in coffee (Coffea arabica L.): identification and validation of new genes for qPCR normalization[J]. Molecular biotechnology, 2013, 53(3): 315-325.
  2. 2.0 2.1 2.2 Cite error: Invalid <ref> tag; no text was provided for refs named ref2