Coffea arabica L.

From ICG
Jump to navigation Jump to search

Description

REFqPCRCoffea arabica L.jpg
  • Coffee is an important crop and is crucial to the economy of many developing countries, generating around US$70 billion per year.
  • This way, coffee is one of the most valuable international exchange commodities in agricultural trade and coffee farmings are crucial to the economy of many developing countries where its cultivation, processing, transportation and marketing provide employment for millions of people worldwide.
  • Abiotic stress is one of the major factors that affect food production worldwide and in tropical countries, drought, salinity, extreme temperatures, nutrient deficiencies and mineral toxicities are among the most important limitants in crop yield.
  • It is important to note that, in a scenario of climate changes, these stresses will be increasingly important, associated with land degradation and declining water quality

Salt and Heat Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
EF1[1][2] Elongation factor 1
  • nitrogen starvation
  • salt
  • heat stress
GW484749.1
  • F:CTGTCCTTGATTGCCACACTTCT
  • R:CTTGGGCTCCTTCTCAAGCTC
NA 60 SYBR
EF1a[1] Elongation factor 1-alpha
  • nitrogen starvation
  • salt
  • heat stress
GT708303.1
  • F:AAGGGAGCTTCCAGCTTTACCT
  • R:TGTGAGAGGTGTGGCAGTCAA
NA 60 SYBR
GAPDH[1] glyceraldehyde-3-phosphate-dehydrogenase
  • nitrogen starvation
  • salt
  • heat stress
GW488886.1
  • F:AGGCTGTTGGGAAAGTTCTTC
  • R:ACTGTTGGAACTCGGAATGC
NA 60 SYBR
MDH[1] Malate dehydrogenase
  • nitrogen starvation
  • salt
  • heat stress
GW464198.1
  • F:CCTGATGTCAACCACGCAACT
  • R:GTGGTTATGAACTCTCCATTCAACC
NA 60 SYBR
UBQ10[1] Polyubiquitin 10
  • nitrogen starvation
  • salt
  • heat stress
GT697658.1
  • F:CAGACCAGCAGAGGCTGATT
  • R:AGAACCAAGTGAAGGGTGGA
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Kenia de Carvalho
  • Email: : keniadecarvalho@gmail.com
  • Institute: Programa de Po´s-Graduac ¸a ˜o em Agronomia (Produc ¸a ˜o Vegetal),Departamento de Fitotecnia e Fitossanitarismo, Universidade Federal do Parana ´, Curitiba, PR CEP 80035-050, Brazil

Citation Statistics

Cited by 22 (Based on Google Scholar [2017-06-16])

Different Air CO2 Supply & Temperature

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
MDH[2] Malate Dehydrogenase
  • Univeral reference gene
GW464198.1
  • F:CCTGATGTCAACCACGCAACT
  • R:CCTGATGTCAACCACGCAACT
100 60 SYBR
ACT [2] Actin
  • Univeral reference gene
GT000704
  • F:AAGCTTGCCTATGTGGCTCTTG
  • R:AAGCTTGCCTATGTGGCTCTTG
100 60 SYBR
S15[2] 40S ribosomal protein S15
  • Univeral reference gene
GR987196
  • F:CAATAGGGGCTTGAAGAGG
  • R:CAATAGGGGCTTGAAGAGG
146 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: José C. Ramalho
  • Email: cochichor@isa.ulisboa.pt
  • Institution: Plant-Environment Interactions and Biodiversity Lab (PlantStress&Biodiversity), Linking Landscape, Environment, Agriculture and Food, Departmento de Recursos Naturais, Ambiente e Território, Instituto Superior de Agronomia, Universidade de Lisboa (ULisboa), Oeiras, Portugal

Multiple Variables in Coffea spp

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPHD[3] Glyceraldehyde 3-phosphate dehydrogenase
  • total assay
  • genotype
  • cold stress
  • drought stress
  • multiple stress
DV692958
  • F:aggctgttgggaaagttcttc
  • R:actgttggaactcggaatgc
NA 60 SYBR
Cycl[3] Cyclophilin
  • total assay
GT007167
  • F:agctctacgcagacacgactcc
  • R:ggtcgatcctttgaagtgcaag
NA 60 SYBR
UBQ10[3] Ubiquitin
  • total assay
  • genotype
  • cold stress
  • multiple stress
DV686961
  • F:cagaccagcagaggctgatt
  • R: agaaccaagtgaagggtgga
NA 60 SYBR
Ap47[3] Clathrin adaptor complexes subunit
  • genotype
DV690764
  • F: ccagattggaggatgctctt
  • R: aaatgcacaagcaacattgg
NA 60 SYBR
EF-1A[3] Elongation factor 1-alpha
  • genotype
  • cold stress
  • drought stress
  • multiple stress
GR996930
  • F: cattgtggtcattggtcatgtc
  • R: acacgcttgtcaattcctcca
NA 60 SYBR
ACT[3] Actin
  • cold stress;*drought stress
  • multiple stress
GT000704
  • F:aagcttgcctatgtggctcttg
  • R:tcacttgtccatctggcaattc
NA 60 SYBR
Apt[3] Adenine phosphoribosyltransferase
  • drought stress
GR996015
  • F: actctccggggctaaaactgtc
  • R:aggtcgtgctggttgagttagg
NA 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: José C. Ramalho
  • Email: goulao@iict.pt
  • Institute: Centro de Ecofisiologia, Bioquímica e Biotecnologia Vegetal, Instituto de Investigação Científica Tropical I.P. (IICT, IP), Av. da República, Quinta do Marquês, 2784-505 Oeiras, Portugal

References

  1. 1.0 1.1 1.2 1.3 1.4 de Carvalho K, Bespalhok Filho J C, Dos Santos T B, et al. Nitrogen starvation, salt and heat stress in coffee (Coffea arabica L.): identification and validation of new genes for qPCR normalization[J]. Molecular biotechnology, 2013, 53(3): 315-325.
  2. 2.0 2.1 2.2 2.3 Kenia de CarvalhoJoão Carlos Bespalhok FilhoTiago Benedito dos SantosSilvia Graciele Hülse de SouzaLuiz Gonzaga Esteves VieiraLuis Filipe Protasio PereiraDouglas Silva Domingues. Nitrogen Starvation, Salt and Heat Stress in Coffee (Coffea arabica L.): Identification and Validation of New Genes for qPCR Normalization. Molecular Biotechnology DOI: 10.1007/s12033-012-9529-4.
  3. 3.0 3.1 3.2 3.3 3.4 3.5 3.6 Cite error: Invalid <ref> tag; no text was provided for refs named ref4

Cite error: <ref> tag with name "ref3" defined in <references> is not used in prior text.