Difference between revisions of "Corchorus capsularis"

From ICG
Jump to navigation Jump to search
Line 118: Line 118:
 
[[Category:mRNA]]   
 
[[Category:mRNA]]   
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 +
[[Category:ACT]] [[Category:DNAJ]] [[Category:EF1α]] [[Category:Tubulin]] [[Category:Ubiquitin]] [[Category:Ubiquitin]]

Revision as of 09:38, 19 June 2017

Description

REFqPCR2015015-1.jpg
  • Jute (Corchorus capsularis L.) is an annual herbaceous fiber crop. It is found predominantly in Southeast Asia and is the second cheapest and most commercially available fiber crop, where by it provides a biodegradable and renewable lignocellulose fiber.
  • In a subsequent investigation’ on the origin of the acidity in jute fiber, the pH-neutralization curves (n.c.) furnished by raw and demineralized fibers, each consisting of one inflection point only, were found to possess remarkable dissimilarity compared to that furnished by D-xylan isolated from the same fiber; the former curves resembling those of very weak acids, and the latter, those of weak acids.
  • Jute isa promising and featured fibermaterialamong many value-added industrial products, due in large part to its high luster, moisture absorption properties, ability for rapid water loss, and easy breakdown. Furthermore, jute has much potential for use in the industrial production of packaging materials. [1] [2].

Stress Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT7[1] Actin 7
  • Biotic stress and NaCl stress subsets
GH985158
  • F:ACAATTGGAGCAGAGCGTTT
  • R:ACAATTGGAGCAGAGCGTTT
166 60 SYBR
UBC[1] Ubiquitin-conjugating enzyme like protein
  • PEG stress subset
GR463733
  • F:CTGCCATCTCCTTTTTCAGC
  • R:CTGCCATCTCCTTTTTCAGC
150 60 SYBR
DnaJ[1] Chaperone protein dnaJ
  • PEG stress subset
GR463675
  • F:TGTATGCACCGAGGAAAATG
  • R:TGTATGCACCGAGGAAAATG
154 60 SYBR
TUBβ[1] Beta-tubulin
  • Different Tisues
JK743820
  • F:CTGGTTCCTCTTCCTCACCA
  • R:CTGGTTCCTCTTCCTCACCA
201 60 SYBR
UBI[1] Ubiquitin extension protein
  • Different Tisues
GH985256
  • F:CCACTCTCCACCTTGTCCTC
  • R:CCACTCTCCACCTTGTCCTC
158 60 SYBR
EF1α[1] Elongation factor 1-alph
  • Different Tisues
GH985217
  • F:GAAGAAGGACCCATCTGGTG
  • R:GAAGAAGGACCCATCTGGTG
130 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jianmin Qi
  • Email: qijm863@163.com
  • Institution: Key Laboratory for Genetics, Breeding and Multiple Utilization of Crops, Fujian Agriculture and Forestry University, Fuzhou, China

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Das NN, Das SC, Mukherjee AK (1984) ON THE ESTER LINKAGE BETWEEN LIGNIN AND 4-O-METHYL-D-GLUCURONO-D-XYLAN IN JUTE FIBER (CORCHORUS-CAPSULARIS). Carbohydrate Research 127, 345-348.
  2. Niu X, Qi J, Zhang G, et al. (2015) Selection of reliable reference genes for quantitative real-time PCR gene expression analysis in Jute (Corchorus capsularis) under stress treatments. Front Plant Sci 6, 848.