Difference between revisions of "Cordyceps militaris"

From ICG
Jump to navigation Jump to search
Line 57: Line 57:
 
[[Category:Fungi]][[Category:mRNA]][[Category:SYBR]]
 
[[Category:Fungi]][[Category:mRNA]][[Category:SYBR]]
 
[[Category:polA]]
 
[[Category:polA]]
 +
[[Category:Different Media]]  [[Category:Different Developmental Stages]]

Revision as of 14:50, 21 June 2017

Description

REFqPCR2014006-1.jpg
  • Cordyceps militaris is considered a model organism for the study of Cordyceps species, which are highly prized in traditional Chinese medicine. Cordyceps militaris (L.) Link, a well-known edible and medicinal fungus, is the type species of Cordyceps that generally parasitizes the larvae or pupae of lepidopteron insects.
  • It is also called northern Cordyceps and is widely used as a substitute for Ophiocordyceps sinensis (Cordyceps sinensis) in traditional Chinese medicine and health supplements. Although more than 400 Cordyceps species have been described, only C. militaris has been commercially cultivated. It is considered a model organism for the study of Cordyceps species, as it can complete its life cycle in vitro.
  • Genus Cordyceps belonging to the division ascomycota, class sordariomycetes, order hypocreales, family clavicipitaceae and is entomopathogenic and endoparasitic fungi. Cordyceps species are known as Dong-Chong-Xia-Cao in China because it is parasitic in the host's body in winter and forms stroma like grass after killing host and absorbing nutrients of host in summer. [1] [2].

Different Developmental Stages & Media

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
rpb1[1] polymerase II large subunit
  • Universial reference gene
KC242729.1
  • F:CTGTTCCCCCTCCTCCTGTG
  • R:CTGTTCCCCCTCCTCCTGTG
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Caihong Dong
  • Email: dongch@im.ac.cn
  • Institution: Laboratorio de Genética, Departamento de Acuicultura, Centro de Investigación Científica y de Educación Superior de Ensenada, Carretera Tijuana-Ensenada N° 3918, Zona Playitas C.P 22860, Ensenada BC, Mexico

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 Lian T, Yang T, Liu G, Sun J, Dong C (2014) Reliable reference gene selection for Cordyceps militaris gene expression studies under different developmental stages and media. FEMS Microbiol Lett 356, 97-104.
  2. Kang N, Lee HH, Park I, Seo YS (2017) Development of High Cordycepin-Producing Cordyceps militaris Strains. Mycobiology 45, 31-38.