Difference between revisions of "Crassostrea gigas"

From ICG
Jump to navigation Jump to search
Line 71: Line 71:
 
[[Category:RPL]] [[Category:RPS]] [[Category:Different Developmental Stages]]
 
[[Category:RPL]] [[Category:RPS]] [[Category:Different Developmental Stages]]
 
[[Category:Animals]]
 
[[Category:Animals]]
 
+
[[Category:SYBR]]
 
[[Category:geNorm]]
 
[[Category:geNorm]]

Revision as of 02:17, 9 August 2017

Description

Crassostrea gigas-1.jpg
  • Crassostrea gigas is one of the bestcharacterized models for biochemical, molecular and genetic studies among the Lophotrochozoa. The C. gigas genome project was completed in 2012, and oyster development was also studied using RNA-seq (49-bp single-end Illumina reads) in developmental samples[1][2].
  • Common Name: Pacific oyster
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RL7[1] Ribosomal protein L7
  • OsHV-1 infected (GA) and uninfected (GB) larvae
CGI_10020975
  • F:TCCCAAGCCAAGGAAGGTTATGC
  • R:CAAAGCGTCCAAGGTGTTTCTCAA
NA 60 SYBR
RS18[1] Ribosomal protein S18
  • OsHV-2 infected (GA) and uninfected (GB) larvae
CGI_10008101
  • F:GCCATCAAGGGTATCGGTAGAC
  • R:CTGCCTGTTAAGGAACCAGTCAG
NA 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Li Li
  • Email: lili@ms.qdio.ac.cn
  • Institute: Lab of Marine Molluscan Genetics and Breeding, Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao, Shandong 266071, China

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. 1.0 1.1 1.2 Du Y, Zhang L, Xu F, Huang B, Zhang G, Li L. Validation of housekeeping genes as internal controls for studying gene expression during Pacific oyster (Crassostrea gigas) development by quantitative real-time PCR. Fish Shellfish Immunol. 2013 Mar;34(3):939-45. doi: 10.1016/j.fsi.2012.12.007. Epub 2013 Jan 26. PubMed PMID: 23357023.
  2. Zhang G, Fang X, Guo X, Li L, Luo R, Xu F, et al. The oyster genome reveals stress adaptation and complexity of shell formation. Nature 2012;490: 49e54.

Categories