Difference between revisions of "Ctenopharyngodon idella"

From ICG
Jump to navigation Jump to search
 
(15 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
[[File:Ctenopharyngodon idella.png|right|200px|link=Ctenopharyngodon idella]]
 +
* '''''Ctenopharyngodon idella''''' constitutes a member of the Cyprinidae family and the only species of the genus Ctenopharyngodon. Grass Carp is a sub-tropical to temperate species native to the large rivers of eastern Asia, where it tends to inhabit lower and middle reaches of these rivers and connected lacustrine habitats. Grass carp is one of the Chinese native carps with commercial importance for freshwater aquaculture, accounting for ~16% of global freshwater aquaculture, and has a vegetarian diet. It grows fast but is susceptible to various stressors and diseases<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Grass carp'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=7959 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
[[File:Ctenopharyngodon idella-1.jpg|right|327px|]]
 
* Grass carp (Ctenopharyngodon idella) is one of the most promising species for aquaculture in China.
 
* Grass carp (Ctenopharyngodon idella) is one of the Chinese native carps with commercial importance for freshwater aquaculture. Grass carp grow fast but are susceptible to various stressors and diseases<ref name="ref1"/> <ref name="ref2"/>.
 
 
=='''''Tissues & Cell Culture'''''==
 
=='''''Tissues & Cell Culture'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 22: Line 22:
 
|
 
|
 
*In individual level in grass carp
 
*In individual level in grass carp
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/GQ266394 '''GQ266394‘'']  
+
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/GQ266394 '''GQ266394''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CGCCAGTGTTGCCTTCGT  
 
* F:CGCCAGTGTTGCCTTCGT  
Line 31: Line 31:
 
|-
 
|-
 
|align="center"| EF-1a<ref name="ref1"/>
 
|align="center"| EF-1a<ref name="ref1"/>
|align="center"| elongation factor 1 a
+
|align="center"| Elongation factor 1 a
 
|
 
|
* CIK cell culture stimulated by poly(I:C) or infected by GCRV
+
* CIK cell culture stimulated by poly(I:C)  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EU047719 '''EU047719‘'']  
+
* CIK cell culture infected by GCRV
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EU047719 '''EU047719''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ATTTCCGACACGGAGAGG  
 
* F:ATTTCCGACACGGAGAGG  
Line 43: Line 44:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 54: Line 55:
 
*'''Name''': Chunrong Yang
 
*'''Name''': Chunrong Yang
 
*'''Email''':  su.jianguo@gmail.com
 
*'''Email''':  su.jianguo@gmail.com
*'''Institute''': College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling 712100, China
+
*'''Institution''': College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling 712100, China
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''65''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=572121485352405842&as_sdt=2005&sciodt=0,5&hl=en '''66'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 64: Line 66:
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
Jiang D, Wu Y, Huang D, Ren X, Wang Y.Effect of blood glucose level on acute stress response of grass carp Ctenopharyngodon idella.Fish Physiol Biochem. 2017 Jun 6. doi: 10.1007/s10695-017-0383-y. [Epub ahead of print]PMID: 28589315  
+
Jiang D, Wu Y, Huang D, Ren X, Wang Y.Effect of blood glucose level on acute stress response of grass carp Ctenopharyngodon idella.Fish Physiol Biochem. 2017 Jun 6. doi: 10.1007/s10695-017-0383-y. [Epub ahead of print]PMID: 28589315.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
Line 72: Line 75:
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:18S rRNA]] [[Category:EF1α]]
 
[[Category:18S rRNA]] [[Category:EF1α]]
 +
[[Category:Tissue Culture]]  [[Category:Cell Culture]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 06:59, 1 September 2017

Description

Ctenopharyngodon idella.png
  • Ctenopharyngodon idella constitutes a member of the Cyprinidae family and the only species of the genus Ctenopharyngodon. Grass Carp is a sub-tropical to temperate species native to the large rivers of eastern Asia, where it tends to inhabit lower and middle reaches of these rivers and connected lacustrine habitats. Grass carp is one of the Chinese native carps with commercial importance for freshwater aquaculture, accounting for ~16% of global freshwater aquaculture, and has a vegetarian diet. It grows fast but is susceptible to various stressors and diseases[1][2].
  • Common Name: Grass carp
  • NCBI Taxonomy

Tissues & Cell Culture

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18S rRNA[1] 18S ribosomal RNA
  • In individual level in grass carp
GQ266394
  • F:CGCCAGTGTTGCCTTCGT
  • R:CGCTCAATCTTCCATCCCTT
99 60 SYBR
EF-1a[1] Elongation factor 1 a
  • CIK cell culture stimulated by poly(I:C)
  • CIK cell culture infected by GCRV
EU047719
  • F:ATTTCCGACACGGAGAGG
  • R:CATGGGTTTAGGATACGCTC
90 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Chunrong Yang
  • Email: su.jianguo@gmail.com
  • Institution: College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling 712100, China

Citation Statistics

Cited by 66 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Su J, Zhang R, Dong J, et al. Evaluation of internal control genes for qRT-PCR normalization in tissues and cell culture for antiviral studies of grass carp (Ctenopharyngodon idella)[J]. Fish & shellfish immunology, 2011, 30(3): 830-835.
  2. Jiang D, Wu Y, Huang D, Ren X, Wang Y.Effect of blood glucose level on acute stress response of grass carp Ctenopharyngodon idella.Fish Physiol Biochem. 2017 Jun 6. doi: 10.1007/s10695-017-0383-y. [Epub ahead of print]PMID: 28589315.

Categories