Ctenopharyngodon idella

From ICG
Jump to navigation Jump to search

Description

Ctenopharyngodon idella-1.jpg
  • Grass carp (Ctenopharyngodon idella) is one of the most promising species for aquaculture in China.
  • Grass carp (Ctenopharyngodon idella) is one of the Chinese native carps with commercial importance for freshwater aquaculture. Grass carp grow fast but are susceptible to various stressors and diseases[1] [2].

Tissues & Cell Culture

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18S rRNA[1] 18S ribosomal RNA
  • In individual level in grass carp
'GQ266394‘
  • F:CGCCAGTGTTGCCTTCGT
  • R:CGCTCAATCTTCCATCCCTT
99 60 SYBR
EF-1a[1] elongation factor 1 a
  • CIK cell culture stimulated by poly(I:C)
  • CIK cell culture infected by GCRV
'EU047719‘
  • F:ATTTCCGACACGGAGAGG
  • R:CATGGGTTTAGGATACGCTC
90 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Chunrong Yang
  • Email: su.jianguo@gmail.com
  • Institute: College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling 712100, China

Citation Statistics

Cited by 65 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Su J, Zhang R, Dong J, et al. Evaluation of internal control genes for qRT-PCR normalization in tissues and cell culture for antiviral studies of grass carp (Ctenopharyngodon idella)[J]. Fish & shellfish immunology, 2011, 30(3): 830-835.
  2. Jiang D, Wu Y, Huang D, Ren X, Wang Y.Effect of blood glucose level on acute stress response of grass carp Ctenopharyngodon idella.Fish Physiol Biochem. 2017 Jun 6. doi: 10.1007/s10695-017-0383-y. [Epub ahead of print]PMID: 28589315.