Difference between revisions of "Cucumis melo"

From ICG
Jump to navigation Jump to search
Line 57: Line 57:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
[[Category:Plants]]

Revision as of 10:26, 16 June 2017

Description

Abiotic Stress Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
CmADP[1] ADP ribosylation factor 1
  • Univeral reference gene
MU47713
  • F:ATATTGCCAACAAGGCGTAGA
  • R:TGCCCGTAAACAAGGGATAAA
93 60 SYBR
CmUBIep[1] Ubiquitin extension protein
  • Univeral reference gene
MU54467
  • F:AAGTGTGGACACAGCAACCA
  • R:AAGCCAAATGGCTCTAAGCA
132 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhilong Bie
  • Email: biezhilong@hotmail.com
  • Institute: Key Laboratory of Horticultural Plant Biology, Ministry of Education/College of Horticulture and Forestry, Huazhong Agricultural University, Wuhan, P. R. China

Citation Statistics

Cited by 22 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 Kong Q, Yuan J, Niu P, et al. Screening suitable reference genes for normalization in reverse transcription quantitative real-time PCR analysis in melon[J]. PLoS One, 2014, 9(1): e87197.