Cucumis melo

From ICG
Jump to navigation Jump to search

Description

REFqPCRCucumis melo.jpg
  • Melon (Cucumis melo L.), a member of the Cucurbitaceae family, ranks as the 9th most cultivated horticultural crop in terms of total world production.
  • In addition to its significant economic value, melon is also an attractive model for the study of valuable biological characteristics, such as fruit ripening, sex determination, and phloem physiology.
  • The full sequence of melon genome is readily available, which greatly facilitates the identification of genes underlying certain traits and the elucidation of mechanisms that regulate relevant characteristics.

Abiotic Stress Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
CmADP[1][2] ADP ribosylation factor 1
  • Univeral reference gene
MU47713
  • F:ATATTGCCAACAAGGCGTAGA
  • R:TGCCCGTAAACAAGGGATAAA
93 60 SYBR
CmUBIep[1] Ubiquitin extension protein
  • Univeral reference gene
MU54467
  • F:AAGTGTGGACACAGCAACCA
  • R:AAGCCAAATGGCTCTAAGCA
132 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhilong Bie
  • Email: biezhilong@hotmail.com
  • Institute: Key Laboratory of Horticultural Plant Biology, Ministry of Education/College of Horticulture and Forestry, Huazhong Agricultural University, Wuhan, P. R. China

Citation Statistics

Cited by 22 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 Kong Q, Yuan J, Niu P, et al. Screening suitable reference genes for normalization in reverse transcription quantitative real-time PCR analysis in melon[J]. PLoS One, 2014, 9(1): e87197.
  2. Qiusheng Kong, Jingxian Yuan, Penghui Niu, Junjun Xie, Wei Jiang, Yuan Huang, and Zhilong Bie. Screening Suitable Reference Genes for Normalization in Reverse Transcription Quantitative Real-Time PCR Analysis in Melon. PLoS One. 2014; 9(1): e87197. doi: 10.1371/journal.pone.0087197. PMCID: PMC3903635.