Cucumis melo

Description

Cucumis melo L. a member of the Cucurbitaceae family, ranks as the 9th most cultivated horticultural crop in terms of total world production. In addition to its significant economic value, melon is also an attractive model for the study of valuable biological characteristics, such as fruit ripening, sex determination, and phloem physiology. The full sequence of melon genome is readily available, which greatly facilitates the identification of genes underlying certain traits and the elucidation of mechanisms that regulate relevant characteristics.
Common Name: Melon
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
CmADP^[1]	ADP ribosylation factor 1	Roots and leaves Fusarium wilt and bacterial fruit blotch Low temperature, salinity, and drought	MU47713	F:ATATTGCCAACAAGGCGTAGA R:TGCCCGTAAACAAGGGATAAA	93	60	SYBR
CmUBIep^[1]	Ubiquitin extension protein	Roots and leaves Fusarium wilt and bacterial fruit blotch Low temperature, salinity, and drought	MU54467	F:AAGTGTGGACACAGCAACCA R:AAGCCAAATGGCTCTAAGCA	132	60	SYBR

Name: Zhilong Bie
Email: biezhilong@hotmail.com
Institution: Key Laboratory of Horticultural Plant Biology, Ministry of Education/College of Horticulture and Forestry, Huazhong Agricultural University, Wuhan, P. R. China

Cited by 24 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 Kong Q, Yuan J, Niu P, et al. Screening suitable reference genes for normalization in reverse transcription quantitative real-time PCR analysis in melon[J]. PLoS One, 2014, 9(1): e87197.