Difference between revisions of "Cucumis sativus"

From ICG
Jump to navigation Jump to search
(Created page with "==Description== =='''''Different Nitrogen Nutrition'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name...")
 
Line 1: Line 1:
 
==Description==
 
==Description==
 +
 +
[[File:Cucumis sativus-1.jpg|right|327px|]]
 +
* Cucumber, Cucumis sativus L., is one of the most important cultivated vegetable crops, ranking 4th in quantity of world vegetable production. Three fourths of this is produced in China where both the area harvested and the quantity produced increase year by year. Many different traits relating to the quality of cucumber fruit have been reported, including the length, weight, and diameter of fruit, uniform immature fruit color, glossy fruit skin, warty fruit, and yellow fruit flesh<ref name="ref1"/> <ref name="ref2"/>.
 +
 
=='''''Different Nitrogen Nutrition'''''==
 
=='''''Different Nitrogen Nutrition'''''==
 
===Reference Genes===
 
===Reference Genes===
Line 76: Line 80:
 
<ref name="ref1">
 
<ref name="ref1">
 
Warzybok A, Migocka M. Reliable reference genes for normalization of gene expression in cucumber grown under different nitrogen nutrition[J]. PLoS One, 2013, 8(9): e72887.
 
Warzybok A, Migocka M. Reliable reference genes for normalization of gene expression in cucumber grown under different nitrogen nutrition[J]. PLoS One, 2013, 8(9): e72887.
 +
</ref>
 +
<ref name="ref2">
 +
Bo K, Ma Z, Chen J, Weng Y. Molecular mapping reveals structural rearrangements and quantitative trait loci underlying traits with local adaptation in semi-wild Xishuangbanna cucumber (Cucumis sativus L. var.
 +
xishuangbannanesis Qi et Yuan). Theor Appl Genet. 2015 Jan;128(1):25-39. doi: 10.1007/s00122-014-2410-z. Epub 2014 Oct 31. PubMed PMID: 25358412.
 
</ref>
 
</ref>
 
</references>
 
</references>

Revision as of 08:33, 16 June 2017

Description

Cucumis sativus-1.jpg
  • Cucumber, Cucumis sativus L., is one of the most important cultivated vegetable crops, ranking 4th in quantity of world vegetable production. Three fourths of this is produced in China where both the area harvested and the quantity produced increase year by year. Many different traits relating to the quality of cucumber fruit have been reported, including the length, weight, and diameter of fruit, uniform immature fruit color, glossy fruit skin, warty fruit, and yellow fruit flesh[1] [2].

Different Nitrogen Nutrition

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
CACS[1] AP-2 complex subunit mu-1
  • Cucumber organs under nitrogen-related stress
GT035008
  • F:GTGCTTTCTTTCTGGAATGC
  • R:TGAACCTCGTCAAATTTACACA
158 60 SYBR
TIP41[1] TIP41-like family protein
  • Cucumber organs under nitrogen-related stress
GW881871
  • F:CAACAGGTGATATTGGATTATGATTATAC
  • R:GCCAGCTCATCCTCATATAAG
221 60 SYBR
F-box[1] F-box/kelch-repeat protein
  • Cucumber organs under nitrogen-related stress
GW881870
  • F:GGTTCATCTGGTGGTCTT
  • R:CTTTAAACGAACGGTCAGTCC
166 60 SYBR
EFa[1] Elongation factor 1-alpha
  • Cucumber organs under nitrogen-related stress
EF446145
  • F:ACTTTATCAAGAACATGATTAC
  • R:TTCCTTCACAATTTCATCG
230 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Anna Warzybok
  • Email: anka.warzybok@biol.uni.wroc.pl
  • Institution: Wrocław University, Institute of Experimental Biology, Department of Plant Molecular Physiology, Wroclaw, Poland

References

  1. 1.0 1.1 1.2 1.3 1.4 Warzybok A, Migocka M. Reliable reference genes for normalization of gene expression in cucumber grown under different nitrogen nutrition[J]. PLoS One, 2013, 8(9): e72887.
  2. Bo K, Ma Z, Chen J, Weng Y. Molecular mapping reveals structural rearrangements and quantitative trait loci underlying traits with local adaptation in semi-wild Xishuangbanna cucumber (Cucumis sativus L. var. xishuangbannanesis Qi et Yuan). Theor Appl Genet. 2015 Jan;128(1):25-39. doi: 10.1007/s00122-014-2410-z. Epub 2014 Oct 31. PubMed PMID: 25358412.