Difference between revisions of "Cucumis sativus"

From ICG
Jump to navigation Jump to search
 
(6 intermediate revisions by 5 users not shown)
Line 7: Line 7:
  
 
=='''''Various Nutrition Conditions'''''==
 
=='''''Various Nutrition Conditions'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 79: Line 79:
 
*'''Institution''': Wrocław University, Institute of Experimental Biology, Department of Plant Molecular Physiology, Wroclaw, Poland
 
*'''Institution''': Wrocław University, Institute of Experimental Biology, Department of Plant Molecular Physiology, Wroclaw, Poland
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''24''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=5511009913552534712&as_sdt=2005&sciodt=0,5&hl=en '''25'''] (Based on Google Scholar [2017-09-01])
  
 
=='''Different Tissues & Hormones Treatment & abiotic stresses'''==
 
=='''Different Tissues & Hormones Treatment & abiotic stresses'''==
  
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 135: Line 135:
 
|}
 
|}
  
−
===Moleculer Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 146: Line 147:
 
*'''Institution''': State Key Laboratory of Crop Genetics and Germplasm Enhancement, College of Horticulture, Nanjing Agricultural University, Nanjing, Jiangsu 210095, People’s Republic of China
 
*'''Institution''': State Key Laboratory of Crop Genetics and Germplasm Enhancement, College of Horticulture, Nanjing Agricultural University, Nanjing, Jiangsu 210095, People’s Republic of China
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''210''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=17001919382398512439&as_sdt=2005&sciodt=0,5&hl=en '''215'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 157: Line 158:
 
</ref>
 
</ref>
 
</references>
 
</references>
−
 
+
=='''Categories'''==
 
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
 
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
 
[[Category:CACS]] [[Category:EF1α]] [[Category:EF1α]] [[Category:F-box]] [[Category:TIP41]] [[Category:Tubulin]] [[Category:Ubiquitin]]
 
[[Category:CACS]] [[Category:EF1α]] [[Category:EF1α]] [[Category:F-box]] [[Category:TIP41]] [[Category:Tubulin]] [[Category:Ubiquitin]]
 
[[Category:Hormone Treatment]]  [[Category:Different Tissues]]  [[Category:Abiotic Stress]]  [[Category:Various  Nutrition Conditions]]
 
[[Category:Hormone Treatment]]  [[Category:Different Tissues]]  [[Category:Abiotic Stress]]  [[Category:Various  Nutrition Conditions]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 09:41, 1 September 2017

Description

Cucumis sativus.png
  • Cucumber, Cucumis sativus L. is one of the most important cultivated vegetable crops, ranking 4th in quantity of world vegetable production. Three fourths of this is produced in China where both the area harvested and the quantity produced increase year by year. Many different traits relating to the quality of cucumber fruit have been reported, including the length, weight, and diameter of fruit, uniform immature fruit color, glossy fruit skin, warty fruit, and yellow fruit flesh[1][2].
  • Common Name: Cucumber
  • NCBI Taxonomy

Various Nutrition Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
CACS[1] AP-2 complex subunit mu-1
  • Cucumber organs under nitrogen-related stress
 GT035008
  • F:GTGCTTTCTTTCTGGAATGC
  • R:TGAACCTCGTCAAATTTACACA
 158 60 SYBR
TIP41[1] TIP41-like family protein
  • Cucumber organs under nitrogen-related stress
 GW881871
  • F:CAACAGGTGATATTGGATTATGATTATAC
  • R:GCCAGCTCATCCTCATATAAG
 221 60 SYBR
F-box[1] F-box/kelch-repeat protein
  • Cucumber organs under nitrogen-related stress
 GW881870
  • F:GGTTCATCTGGTGGTCTT
  • R:CTTTAAACGAACGGTCAGTCC
 166 60 SYBR
EF1α[1] Elongation factor 1-alpha
  • Cucumber organs under nitrogen-related stress
 EF446145
  • F:ACTTTATCAAGAACATGATTAC
  • R:TTCCTTCACAATTTCATCG
 230 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Anna Warzybok
  • Email: anka.warzybok@biol.uni.wroc.pl
  • Institution: Wrocław University, Institute of Experimental Biology, Department of Plant Molecular Physiology, Wroclaw, Poland

Citation Statistics

Cited by 25 (Based on Google Scholar [2017-09-01])

Different Tissues & Hormones Treatment & abiotic stresses

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
EF1α[2] Elongation factor 1-α
  • Different tissues
  • Abiotic stress
 EF446145
  • F:ACTGTGCTGTCCTCATTATTG
  • R:AGGGTGAAAGCAAGAAGAGC
 98 60 SYBR
UBI-ep[2] Ubiquitin extension protein
  • Different tissues
  • Different hormones treatments
 AY372537
  • F:CACCAAGCCCAAGAAGATC
  • R:TAAACCTAATCACCACCAGC
 220 60 SYBR
TUA[2] α-Tubulin
  • Different tissues
  • Different hormones treatments
 AJ715498
  • F:ACGCTGTTGGTGGTGGTAC
  • R:GAGAGGGGTAAACAGTGAATC
 106 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jinfeng Chen
  • Email: jfchen@njau.edu.cn
  • Institution: State Key Laboratory of Crop Genetics and Germplasm Enhancement, College of Horticulture, Nanjing Agricultural University, Nanjing, Jiangsu 210095, People’s Republic of China

Citation Statistics

Cited by 215 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 Warzybok A, Migocka M. Reliable reference genes for normalization of gene expression in cucumber grown under different nitrogen nutrition[J]. PLoS One, 2013, 8(9): e72887.
  2. ↑ 2.0 2.1 2.2 2.3 Wan H, Zhao Z, Qian C, et al. Selection of appropriate reference genes for gene expression studies by quantitative real-time polymerase chain reaction in cucumber[J]. Analytical biochemistry, 2010, 399(2): 257-261.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Cucumis_sativus&oldid=8844"