Cucumis sativus

Description

Cucumber, Cucumis sativus L., is one of the most important cultivated vegetable crops, ranking 4th in quantity of world vegetable production. Three fourths of this is produced in China where both the area harvested and the quantity produced increase year by year. Many different traits relating to the quality of cucumber fruit have been reported, including the length, weight, and diameter of fruit, uniform immature fruit color, glossy fruit skin, warty fruit, and yellow fruit flesh^[1] ^[2].

Gene Symbol	Gene Name	Application Scope	Accession Number	Primer	Size [bp]	Tm [℃]	Detection
CACS^[1]	AP-2 complex subunit mu-1	Cucumber organs under nitrogen-related stress	GT035008	F:GTGCTTTCTTTCTGGAATGC R:TGAACCTCGTCAAATTTACACA	158	60	SYBR
TIP41^[1]	TIP41-like family protein	Cucumber organs under nitrogen-related stress	GW881871	F:CAACAGGTGATATTGGATTATGATTATAC R:GCCAGCTCATCCTCATATAAG	221	60	SYBR
F-box^[1]	F-box/kelch-repeat protein	Cucumber organs under nitrogen-related stress	GW881870	F:GGTTCATCTGGTGGTCTT R:CTTTAAACGAACGGTCAGTCC	166	60	SYBR
EF1α^[1]	Elongation factor 1-alpha	Cucumber organs under nitrogen-related stress	EF446145	F:ACTTTATCAAGAACATGATTAC R:TTCCTTCACAATTTCATCG	230	60	SYBR

Name: Anna Warzybok
Email: anka.warzybok@biol.uni.wroc.pl
Institution: Wrocław University, Institute of Experimental Biology, Department of Plant Molecular Physiology, Wroclaw, Poland

Cited by 24 (Based on Google Scholar [2017-06-16])

Gene Symbol	Gene Name	Application Scope	Accession Number	Primer	Size [bp]	Tm [℃]	Detection
EF1α^[2]	Elongation factor 1-α	Different tissues；*abiotic stress treatments	EF446145	F:ACTGTGCTGTCCTCATTATTG R:AGGGTGAAAGCAAGAAGAGC	98	60	SYBR
UBI-ep^[2]	Ubiquitin extension protein	Different tissues; Treated with different hormones	AY372537	F:CACCAAGCCCAAGAAGATC R:TAAACCTAATCACCACCAGC	220	60	SYBR
TUA^[2]	α-Tubulin	Different tissues; Treated with different hormones	AJ715498	F:ACGCTGTTGGTGGTGGTAC R:GAGAGGGGTAAACAGTGAATC	106	60	SYBR

Name: Jinfeng Chen
Email: jfchen@njau.edu.cn
Institution: State Key Laboratory of Crop Genetics and Germplasm Enhancement, College of Horticulture, Nanjing Agricultural University, Nanjing, Jiangsu 210095, People’s Republic of China

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 Warzybok A, Migocka M. Reliable reference genes for normalization of gene expression in cucumber grown under different nitrogen nutrition[J]. PLoS One, 2013, 8(9): e72887.
↑ ^2.0 ^2.1 ^2.2 ^2.3 Wan H, Zhao Z, Qian C, et al. Selection of appropriate reference genes for gene expression studies by quantitative real-time polymerase chain reaction in cucumber[J]. Analytical biochemistry, 2010, 399(2): 257-261.