Cucumis sativus

From ICG
Revision as of 07:25, 16 June 2017 by ICG Expert4 (talk | contribs) (Created page with "==Description== =='''''Different Nitrogen Nutrition'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Different Nitrogen Nutrition

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
CACS[1] AP-2 complex subunit mu-1
  • Cucumber organs under nitrogen-related stress
GT035008
  • F:GTGCTTTCTTTCTGGAATGC
  • R:TGAACCTCGTCAAATTTACACA
158 60 SYBR
TIP41[1] TIP41-like family protein
  • Cucumber organs under nitrogen-related stress
GW881871
  • F:CAACAGGTGATATTGGATTATGATTATAC
  • R:GCCAGCTCATCCTCATATAAG
221 60 SYBR
F-box[1] F-box/kelch-repeat protein
  • Cucumber organs under nitrogen-related stress
GW881870
  • F:GGTTCATCTGGTGGTCTT
  • R:CTTTAAACGAACGGTCAGTCC
166 60 SYBR
EFa[1] Elongation factor 1-alpha
  • Cucumber organs under nitrogen-related stress
EF446145
  • F:ACTTTATCAAGAACATGATTAC
  • R:TTCCTTCACAATTTCATCG
230 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Anna Warzybok
  • Email: anka.warzybok@biol.uni.wroc.pl
  • Institution: Wrocław University, Institute of Experimental Biology, Department of Plant Molecular Physiology, Wroclaw, Poland

References

  1. 1.0 1.1 1.2 1.3 Warzybok A, Migocka M. Reliable reference genes for normalization of gene expression in cucumber grown under different nitrogen nutrition[J]. PLoS One, 2013, 8(9): e72887.