Difference between revisions of "Cyclamen persicum"

From ICG
Jump to navigation Jump to search
 
(11 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
[[File:Cyclamen persicum.png|right|200px|link=Cyclamen persicum]]
 +
* '''''Cyclamen persicum mill.''''' is a species of commercially valuable, winter-blooming herbaceous perennial plant, with the flowering season taking place from December to March. Cyclamen is native to Europe and is distributed in Mediterranean countries, western Asia, and northern Africa. It is an important horticultural crop which is sold as an ornamental pot plant in high numbers, with an annual production estimated at about 150–200 million plants worldwide<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Persian cyclamen'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=87530 <font color=blue>'''NCBI Taxonomy'''</font>]
  
[[File:Cyclamen persicum-1.jpg|right|327px|]]
+
=='''''Cell Cultures'''''==
* Cyclamen (Cyclamen persicum mill.) is an important horticultural crop which is sold as an ornamental pot plant in high numbers, with an annual production estimated at about 150–200 million plants worldwide. Cyclamen persicum (cyclamen) is a commercially valuable, winter-blooming perennial plant<ref name="ref1"/> <ref name="ref2"/>.
+
===Internal Control Genes===
 
 
=='''cell cultures'''==
 
 
 
===Reference Genes===
 
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 55: Line 55:
 
|-
 
|-
 
|align="center"| COG<ref name="ref1"/>
 
|align="center"| COG<ref name="ref1"/>
|align="center"| putative conserved oligomeric Golgi (COG) complex component
+
|align="center"| Putative conserved oligomeric Golgi (COG) complex component
 
|
 
|
 
*Induced calli and somatic embryos
 
*Induced calli and somatic embryos
Line 67: Line 67:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 77: Line 77:
 
*'''Name''': Annette Hohe
 
*'''Name''': Annette Hohe
 
*'''Email''': hohe@erfurt.igzev.de
 
*'''Email''': hohe@erfurt.igzev.de
*'''Institute''': Leibniz-Institute of Vegetable and Ornamental Crops, Erfurt, Germany
+
*'''Institution''': Leibniz-Institute of Vegetable and Ornamental Crops, Erfurt, Germany
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''12''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=16366628510058627357&as_sdt=2005&sciodt=0,5&hl=en '''13'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 90: Line 91:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Plants]]
 
[[Category:Plants]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
Line 95: Line 97:
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:ABCT]] [[Category:COG]] [[Category:Histone]] [[Category:VATP]]
 
[[Category:ABCT]] [[Category:COG]] [[Category:Histone]] [[Category:VATP]]
 +
[[Category:Cell Culture]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 09:42, 1 September 2017

Description

Cyclamen persicum.png
  • Cyclamen persicum mill. is a species of commercially valuable, winter-blooming herbaceous perennial plant, with the flowering season taking place from December to March. Cyclamen is native to Europe and is distributed in Mediterranean countries, western Asia, and northern Africa. It is an important horticultural crop which is sold as an ornamental pot plant in high numbers, with an annual production estimated at about 150–200 million plants worldwide[1][2].
  • Common Name: Persian cyclamen
  • NCBI Taxonomy

Cell Cultures

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
V-ATPase G subunit 1[1] V-ATPase G subunit 1
  • Induced calli and somatic embryos
AJ887447
  • F:AGATCGGGTGCTAATGTGA
  • R:AATCCCAGCATCGTTTTTCT
79 59 SYBR
ABC transporter ATPase[1] ABC transporter ATPase
  • Induced calli and somatic embryos
AJ886326
  • F:TGGCGAAACGTATTGAGAA
  • R:AGTTGCTGGGGTTAGCATTT
98 59 SYBR
H3-K9-HMTase 4[1] Histone H3-K9 methyltransferase 4
  • Induced calli and somatic embryos
AJ885940
  • F:GGTGTGAGATCTTGGGATT
  • R:GTCAAGCCCCTTCATTGTTT
148 59 SYBR
COG[1] Putative conserved oligomeric Golgi (COG) complex component
  • Induced calli and somatic embryos
AJ887962
  • F:TATCCAACGCCGACAAAATA
  • R:GGAATGCTTCGATTTTTGCT
105 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Annette Hohe
  • Email: hohe@erfurt.igzev.de
  • Institution: Leibniz-Institute of Vegetable and Ornamental Crops, Erfurt, Germany

Citation Statistics

Cited by 13 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Hoenemann C, Hohe A. Selection of reference genes for normalization of quantitative real-time PCR in cell cultures of Cyclamen persicum[J]. Electronic Journal of Biotechnology, 2011, 14(1): 12-13.
  2. Tanaka Y, Oshima Y, Yamamura T, Sugiyama M, Mitsuda N, Ohtsubo N, Ohme-Takagi M, Terakawa T.Multi-petal cyclamen flowers produced by AGAMOUS chimeric repressor expression.Sci Rep. 2013;3:2641. doi: 10.1038/srep02641.PMID: 24026510 PMCID: PMC3770964.

Categories