Difference between revisions of "Cyclamen persicum"

From ICG
Jump to navigation Jump to search
Line 77: Line 77:
 
*'''Name''': Annette Hohe
 
*'''Name''': Annette Hohe
 
*'''Email''': hohe@erfurt.igzev.de
 
*'''Email''': hohe@erfurt.igzev.de
*'''Institute''': Leibniz-Institute of Vegetable and Ornamental Crops, Erfurt, Germany
+
*'''Institution''': Leibniz-Institute of Vegetable and Ornamental Crops, Erfurt, Germany
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
 
Cited by '''12''' (Based on Google Scholar [2017-06-16])
 
Cited by '''12''' (Based on Google Scholar [2017-06-16])

Revision as of 15:02, 22 June 2017

Description

Cyclamen persicum-1.jpg
  • Cyclamen (Cyclamen persicum mill.) is an important horticultural crop which is sold as an ornamental pot plant in high numbers, with an annual production estimated at about 150–200 million plants worldwide. Cyclamen persicum (cyclamen) is a commercially valuable, winter-blooming perennial plant[1] [2].

cell cultures

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
V-ATPase G subunit 1[1] V-ATPase G subunit 1
  • Induced calli and somatic embryos
AJ887447
  • F:AGATCGGGTGCTAATGTGA
  • R:AATCCCAGCATCGTTTTTCT
79 59 SYBR
ABC transporter ATPase[1] ABC transporter ATPase
  • Induced calli and somatic embryos
AJ886326
  • F:TGGCGAAACGTATTGAGAA
  • R:AGTTGCTGGGGTTAGCATTT
98 59 SYBR
H3-K9-HMTase 4[1] Histone H3-K9 methyltransferase 4
  • Induced calli and somatic embryos
AJ885940
  • F:GGTGTGAGATCTTGGGATT
  • R:GTCAAGCCCCTTCATTGTTT
148 59 SYBR
COG[1] Putative conserved oligomeric Golgi (COG) complex component
  • Induced calli and somatic embryos
AJ887962
  • F:TATCCAACGCCGACAAAATA
  • R:GGAATGCTTCGATTTTTGCT
105 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Annette Hohe
  • Email: hohe@erfurt.igzev.de
  • Institution: Leibniz-Institute of Vegetable and Ornamental Crops, Erfurt, Germany

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 Hoenemann C, Hohe A. Selection of reference genes for normalization of quantitative real-time PCR in cell cultures of Cyclamen persicum[J]. Electronic Journal of Biotechnology, 2011, 14(1): 12-13.
  2. Tanaka Y, Oshima Y, Yamamura T, Sugiyama M, Mitsuda N, Ohtsubo N, Ohme-Takagi M, Terakawa T.Multi-petal cyclamen flowers produced by AGAMOUS chimeric repressor expression.Sci Rep. 2013;3:2641. doi: 10.1038/srep02641.PMID: 24026510 PMCID: PMC3770964.