Cymbidium kanran

From ICG
Jump to navigation Jump to search

Description

Cymbidium kanran.png
  • Cymbidium kanran is an important commercial member of the Chinese orchid family due to its delicate fragrance, attractive color, shape, and the scent of its flowers. It possesses a high economic value as an ornamental plant. As the focus in evaluation of orchid, the labellum exhibits various morphological variations. It is exclusively distributed in a few neighboring countries in Northeast Asia (China, Japan, Korea, and Taiwan), and now among the endangered species facing extinction. Jeju Island is the only place in Korea where a small number of wild populations still exist[1][2].
  • Common Name: Cold-growing cymbidium
  • NCBI Taxonomy

Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT[1] Actin
  • ABA,NaCl,cold,CuSO4,PbAC treatment
NA
  • F:CTAGCATAAAGAGAGAGCACGGC
  • R:GCAAATAGAGAGAAGATGACCCA
95 60 SYBR
RPS3[1] RPS3
  • NAA, 6-BA and GA treatments
NA
  • F:TGAAGCCAATGCAGAACAAACG
  • R:ATGGATTTCACCACCGACAAGC
121 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Boyun Yang
  • Email: 572460991@163.com
  • Institution: Jiangxi Key Laboratory of Plant Resources, School of Life Science and Food Engineering, Nanchang University, Nanchang 330031, Jiangxi, People’s Republic of China

Citation Statistics

Cited by 96 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Luo H, Luo K, Luo L, et al. (2014) Evaluation of candidate reference genes for gene expression studies in Cymbidium kanran. Scientia Horticulturae 167, 43-48.
  2. Hong JW, Suh H, Kim OH, Lee NS (2015) Molecular Identification of Mycorrhizae of Cymbidium kanran (Orchidaceae) on Jeju Island, Korea. Mycobiology 43, 475-480.