Difference between revisions of "Cynodon dactylon"

From ICG
Jump to navigation Jump to search
Line 135: Line 135:
  
 
[[Category:Plants]]
 
[[Category:Plants]]
 +
[[Category:mRNA]] 
 +
[[Category:TaqMan]]

Revision as of 07:43, 19 June 2017

Description

REFqPCR2015010-1.jpg
  • ermudagrass (Cynodon dactylon) is a perennial grass species widely used throughout turfgrass and forage settings. This species exhibits a wide range of genetic variability in stress tolerance, having superior drought and heat tolerance, but relatively poor salinity and cold tolerance.
  • Bermudagrass is very abundant in China and widely distributed in tropical, subtropical and warm-temperate regions. Several studies have investigated the genetic diversity of Chinese wild bermudagrass based on DNA molecular markers. The studies mentioned above investigating the genetic diversity and relationships of bermudagrass accessions were mainly based on traditional cluster analysis which could provide an easy and effective method in estimating the genetic diversity of accessions.
  • Bermudagrass [Cynodon dactylon (L.) Pers.], an important turfgrass used in public parks, home lawns, golf courses and sports fields, is widely distributed in China. In the present study, sequence-related amplified polymorphism (SRAP) markers were used to assess genetic diversity and population structure among 157 indigenous bermudagrass genotypes from 20 provinces in China. [1] [2].

Different Abiotic Stresses

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PP2A[1] Protein phosphatase 2A
  • Roots and leaves under salt stress,
  • Leaves under drought & heatstress
  • Roots exposed to cold and heat stress
ES306101
  • F:ACTACTTCCCCTTGACGGC
  • R:ACTACTTCCCCTTGACGGC
183 60 TaqMan
CACS[1] Clathrin adaptor complex subunit
  • Roots and leaves under salt stress
  • Leaves under drought stress
  • Roots exposed to cold & heat stress
ES306283
  • F:TCCTGAAGGTTTGGGAGAAG
  • R:TCCTGAAGGTTTGGGAGAAG
129 60 TaqMan
EF1α[1] Elongation factor 1a
  • Roots under drought stress
ES296122
  • F:TGTCCCTGTCGGTCGTGTT
  • R:TGTCCCTGTCGGTCGTGTT
112 60 TaqMan
TIP41[1] TIP41-like family protein
  • Leaves under heat stress
  • Roots under drought stress
ES303032
  • F:AATTGACCTTGTCGCTCTTTC
  • R:AATTGACCTTGTCGCTCTTTC
126 60 TaqMan
UPL7[1] E3 ubiquitin-protein ligase
  • Leaves under cold stress
ES295712
  • F:CTACGGCAGCACAAACCATC
  • R:CTACGGCAGCACAAACCATC
188 60 TaqMan
TUB[1] Alpha tubulin
  • Leaves under cold stress
ES302563
  • F:AAGGACTACGAGGAGGTCGG
  • R:AAGGACTACGAGGAGGTCGG
120 60 TaqMan
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Leaves under cold stress
ES302571
  • F:CCCTTCATCACCACCGACTA
  • R:CCCTTCATCACCACCGACTA
157 60 TaqMan

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Martin Filion
  • Email: martin.filion@umoncton.ca
  • Institution: Department of Biology, Université de Moncton, 18 Antonine-Maillet Ave, Moncton, NB E1A 3E9, Canada

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Chen Y, Tan Z, Hu B, et al. (2014) Selection and validation of reference genes for target gene analysis with quantitative RT-PCR in leaves and roots of bermudagrass under four different abiotic stresses. Physiol Plant.
  2. Zheng Y, Xu S, Liu J, Zhao Y, Liu J (2017) Genetic diversity and population structure of Chinese natural bermudagrass [Cynodon dactylon (L.) Pers.] germplasm based on SRAP markers. PLoS One 12, e0177508.