Cynodon dactylon

Description

Cynodon dactylon, a perennial grass species, is an important turfgrass widely used in public parks, home lawns, golf courses and sports fields. In addition to turfgrass, it is also used as forage settings. It is abundant in China and widely distributed in tropical, subtropical and warm-temperate regions. It exhibits a wide range of genetic variability in stress tolerance, having superior drought and heat tolerance, but relatively poor salinity and cold tolerance^[1] ^[2].
Common Name: Vilfa stellata, Dūrvā grass, Dhoob, Bermuda grass, Dubo, Dog's tooth grass, Bahama grass, Devil's grass, Couch grass
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
PP2A^[1]	Protein phosphatase 2A	Roots and leaves under salt stress Leaves under drought & heat stress Roots exposed to cold and heat stress	ES306101	F:ACTACTTCCCCTTGACGGC R:AAATACCCCAACCACATCG	183	60	TaqMan
CACS^[1]	Clathrin adaptor complex subunit	Roots and leaves under salt stress Leaves under drought stress Roots exposed to cold & heat stress	ES306283	F:TCCTGAAGGTTTGGGAGAAG R:AAATAACAGTTCCGAAGAGCC	129	60	TaqMan
EF1α^[1]	Elongation factor 1a	Roots under drought stress	ES296122	F:TGTCCCTGTCGGTCGTGTT R:AGCCTCATGGTGCATCTCA	112	60	TaqMan
TIP41^[1]	TIP41-like family protein	Leaves under heat stress Roots under drought stress	ES303032	F:AATTGACCTTGTCGCTCTTTC R:GTCGGCATTACCCTCACTCT	126	60	TaqMan
UPL7^[1]	E3 ubiquitin-protein ligase	Leaves under cold stress	ES295712	F:CTACGGCAGCACAAACCATC R:TGTACAAACTCCCCGAAAGG	188	60	TaqMan
TUB^[1]	Alpha tubulin	Leaves under cold stress	ES302563	F:AAGGACTACGAGGAGGTCGG R:ACTGGATAGCAGCGGCACA	120	60	TaqMan
GAPDH^[1]	Glyceraldehyde 3-phosphate dehydrogenase	Leaves under cold stress	ES302571	F:CCCTTCATCACCACCGACTA R:GAATCTCCTCTGGGTTCCTG	157	60	TaqMan

Name: Martin Filion
Email: martin.filion@umoncton.ca
Institution: Department of Biology, Université de Moncton, 18 Antonine-Maillet Ave, Moncton, NB E1A 3E9, Canada

Cited by 9 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 Chen Y, Tan Z, Hu B, et al. (2014) Selection and validation of reference genes for target gene analysis with quantitative RT-PCR in leaves and roots of bermudagrass under four different abiotic stresses. Physiol Plant.
↑ Zheng Y, Xu S, Liu J, Zhao Y, Liu J (2017) Genetic diversity and population structure of Chinese natural bermudagrass [Cynodon dactylon (L.) Pers.] germplasm based on SRAP markers. PLoS One 12, e0177508.