Difference between revisions of "Cynoglossus semilaevis"

From ICG
Jump to navigation Jump to search
 
(4 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:Cynoglossus semilaevis-1.jpg|right|200px|link=Cynoglossus semilaevis]]
 
[[File:Cynoglossus semilaevis-1.jpg|right|200px|link=Cynoglossus semilaevis]]
* '''''Cynoglossus semilaevis''''', an increasingly important tongue sole in China' s fish farming industry, exhibits a typical sexual growth dimorphism in which females grow 2 to 3 times faster and larger than males under either cultural or natural conditions. It is a typical species provides a perfect material to study the mechanism of sexual growth dimorphism<ref name="ref1"/>.
+
* '''''Cynoglossus semilaevis''''', an increasingly important tongue sole in China' s fish farming industry, exhibits a typical sexual growth dimorphism in which females grow 2 to 3 times faster and larger than males under either cultural or natural conditions. It is a typical species provides a perfect material to study the mechanism of sexual growth dimorphism <ref name="ref1"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Tongue sole'''
 
* <font color=blue>'''Common Name:'''</font> '''Tongue sole'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=244447 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=244447 <font color=blue>'''NCBI Taxonomy'''</font>]
Line 44: Line 44:
 
|}
 
|}
  
===Moleculer types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 56: Line 57:
 
*'''Institute''': Key Laboratory of Sustainable Development of Marine Fisheries of Ministry of Agriculture, Shandong Provincial Key Laboratory of Fishery Resources and Eco-environment, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
 
*'''Institute''': Key Laboratory of Sustainable Development of Marine Fisheries of Ministry of Agriculture, Shandong Provincial Key Laboratory of Fishery Resources and Eco-environment, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''??''' (Based on Google Scholar [2017-08-01])
+
Cited by [https://scholar.google.com/scholar?cites=16443959810289055111&as_sdt=2005&sciodt=0,5&hl=en '''3'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 64: Line 65:
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
Ma, Qian, et al. "Evaluation of reference genes for quantitative real-time PCR analysis of gene expression during early development processes of the tongue sole (Cynoglossus semilaevis)." Acta Oceanologica Sinica 34.10 (2015): 90-97.
+
Ma, Qian, et al. Evaluation of reference genes for quantitative real-time PCR analysis of gene expression during early development processes of the tongue sole (Cynoglossus semilaevis). Acta Oceanologica Sinica 34.10 (2015): 90-97.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 
=='''Categories'''==
 
=='''Categories'''==
 
[[Category:Different Developmental Stages]]
 
[[Category:Different Developmental Stages]]

Latest revision as of 05:13, 1 September 2017

Description

Cynoglossus semilaevis-1.jpg
  • Cynoglossus semilaevis, an increasingly important tongue sole in China' s fish farming industry, exhibits a typical sexual growth dimorphism in which females grow 2 to 3 times faster and larger than males under either cultural or natural conditions. It is a typical species provides a perfect material to study the mechanism of sexual growth dimorphism [1].
  • Common Name: Tongue sole
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18S[2] 18S ribosomal RNA
  • Early developmental stages (from oosphere to 90 days old)
  • Embryo and post-hatching periods
NM_003134
  • F:CCTGAGAAACGGCTACCACATCC
  • R:CCAATTACAGGGCCTCGAAAG
119 60 SYBR
TUBA[2] tubulin alpha chain
  • Embryo and post-hatching periods
NA
  • F:ATGGCCTGTTGCCTCCTGTA
  • R:TGGTAGTTGATGCCCACCTTG
146 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: ZHUANG Zhimeng
  • Email: zhuangzm@ysfri.ac.cn
  • Institute: Key Laboratory of Sustainable Development of Marine Fisheries of Ministry of Agriculture, Shandong Provincial Key Laboratory of Fishery Resources and Eco-environment, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China

Citation Statistics

Cited by 3 (Based on Google Scholar [2017-09-01])

References

  1. Ma Q, Zhuang Z, Feng W, et al. Evaluation of reference genes for quantitative real-time PCR analysis of gene expression during early development processes of the tongue sole (Cynoglossus semilaevis)[J]. Acta Oceanologica Sinica, 2015, 34(10): 90-97.
  2. 2.0 2.1 Ma, Qian, et al. Evaluation of reference genes for quantitative real-time PCR analysis of gene expression during early development processes of the tongue sole (Cynoglossus semilaevis). Acta Oceanologica Sinica 34.10 (2015): 90-97.

Categories