Difference between revisions of "Cynoglossus semilaevis"

From ICG
Jump to navigation Jump to search
Line 44: Line 44:
 
|}
 
|}
  
===Moleculer types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']

Revision as of 08:27, 17 August 2017

Description

Cynoglossus semilaevis-1.jpg
  • Cynoglossus semilaevis, an increasingly important tongue sole in China' s fish farming industry, exhibits a typical sexual growth dimorphism in which females grow 2 to 3 times faster and larger than males under either cultural or natural conditions. It is a typical species provides a perfect material to study the mechanism of sexual growth dimorphism [1].
  • Common Name: Tongue sole
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18S[2] 18S ribosomal RNA
  • Early developmental stages (from oosphere to 90 days old)
  • Embryo and post-hatching periods
NM_003134
  • F:CCTGAGAAACGGCTACCACATCC
  • R:CCAATTACAGGGCCTCGAAAG
119 60 SYBR
TUBA[2] tubulin alpha chain
  • Embryo and post-hatching periods
NA
  • F:ATGGCCTGTTGCCTCCTGTA
  • R:TGGTAGTTGATGCCCACCTTG
146 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: ZHUANG Zhimeng
  • Email: zhuangzm@ysfri.ac.cn
  • Institute: Key Laboratory of Sustainable Development of Marine Fisheries of Ministry of Agriculture, Shandong Provincial Key Laboratory of Fishery Resources and Eco-environment, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China

Citation Statistics

Cited by 3 (Based on Google Scholar [2017-08-10])

References

  1. Ma Q, Zhuang Z, Feng W, et al. Evaluation of reference genes for quantitative real-time PCR analysis of gene expression during early development processes of the tongue sole (Cynoglossus semilaevis)[J]. Acta Oceanologica Sinica, 2015, 34(10): 90-97.
  2. 2.0 2.1 Ma, Qian, et al. Evaluation of reference genes for quantitative real-time PCR analysis of gene expression during early development processes of the tongue sole (Cynoglossus semilaevis). Acta Oceanologica Sinica 34.10 (2015): 90-97.

Categories