Difference between revisions of "Danio rerio"

From ICG
Jump to navigation Jump to search
 
(11 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2016008-1.jpg|right|227px|]]
+
[[File:Danio rerio.png|right|200px|link=Danio rerio]]
* The zebrafish (Danio rerio) represents an ideal genetic system for the study of both developmental biology and disease. The many attractions of this small freshwater species include the following: it is easy to maintain at high densities in the laboratory, large numbers of embryos can be produced year round, fish grow to sexual maturity within four months and the optically transparent embryos develop externally.
+
* '''''Danio rerio''''' represents an ideal genetic system for the study of both developmental biology and disease that are not provided by other model systems. It has been the model of choice amongst developmental biologists for many years. The many attractions of this small freshwater species include the following: it is easy to maintain at high densities in the laboratory, large numbers of embryos can be produced year round, fish grow to sexual maturity within four months and the optically transparent embryos develop externally <ref name="ref1"/> <ref name="ref2"/>.
* The zebrafish has been the model of choice amongst developmental biologists for many years. This small freshwater species offers many advantages to the study of organ and tissue development that are not provided by other model systems.<ref name="ref1"/> <ref name="ref2"/>.
+
* <font color=blue>'''Common Name:'''</font> '''Zebrafish'''
* <font color=blue>'''Common Name:'''</font> '''zebrafish'''
 
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=7955 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=7955 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Developmental Stages & Tissues & Abiotic Stress'''''==
 
=='''''Different Developmental Stages & Tissues & Abiotic Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 26: Line 25:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TATTGTTGATTGTTGCTGAGGG
 
* F:TATTGTTGATTGTTGCTGAGGG
* R:TATTGTTGATTGTTGCTGAGGG
+
* R:ACTCTGAGAGATGTACACAGGA
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 60
 
|align="center"| 60
Line 38: Line 37:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TGACTGTTGACCCACCTTACAG
 
* F:TGACTGTTGACCCACCTTACAG
* R:TGACTGTTGACCCACCTTACAG
+
* R:GAAATAAAAGCAAGTAACCCCG
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 60
 
|align="center"| 60
Line 50: Line 49:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TGGTGAGGTGTGAGGGTATCAAC
 
* F:TGGTGAGGTGTGAGGGTATCAAC
* R:TGGTGAGGTGTGAGGGTATCAAC
+
* R:AATTTGVGTGTGGGTTTCAGAC
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 60
 
|align="center"| 60
Line 56: Line 55:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 69: Line 68:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''4''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=17076100631804625057&as_sdt=2005&sciodt=0,5&hl=en '''6'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 80: Line 79:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
[[Category:mRNA]] 
+
[[Category:mRNA]]
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:RPL]] [[Category:SEP]] [[Category:Ubiquitin]]
 
[[Category:RPL]] [[Category:SEP]] [[Category:Ubiquitin]]
 
[[Category:Different Tissues]]  [[Category:Different Developmental Stages]]
 
[[Category:Different Tissues]]  [[Category:Different Developmental Stages]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
 +
[[Category:Delta Ct]]

Latest revision as of 07:04, 1 September 2017

Description

Danio rerio.png
  • Danio rerio represents an ideal genetic system for the study of both developmental biology and disease that are not provided by other model systems. It has been the model of choice amongst developmental biologists for many years. The many attractions of this small freshwater species include the following: it is easy to maintain at high densities in the laboratory, large numbers of embryos can be produced year round, fish grow to sexual maturity within four months and the optically transparent embryos develop externally [1] [2].
  • Common Name: Zebrafish
  • NCBI Taxonomy

Different Developmental Stages & Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
sep15[1] Selenoprotein F precursor 15
  • Different tissue types
1102817965
  • F:TATTGTTGATTGTTGCTGAGGG
  • R:ACTCTGAGAGATGTACACAGGA
NA 60 SYBR
ube2a[1] Danio rerio ubiquitin-conjugating enzyme E2A (ube2a)
  • Different developmental stages
NM_201273
  • F:TGACTGTTGACCCACCTTACAG
  • R:GAAATAAAAGCAAGTAACCCCG
NA 60 SYBR
rpl13a[1] 60S ribosomal protein L13a
  • Different chemical treatments
NM_212784
  • F:TGGTGAGGTGTGAGGGTATCAAC
  • R:AATTTGVGTGTGGGTTTCAGAC
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: H. Xu
  • Email: xuhyzqh@163.com
  • Institution: Pearl River Fisheries Research Institute, Chinese Academic of Fishery Sciences, Guangzhou 510380, China and †Department of Biological Sciences, National University of Singapore, Singapore 117543, Singapore

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Xu H, Li C, Zeng Q, et al. (2016) Genome-wide identification of suitable zebrafish Danio rerio reference genes for normalization of gene expression data by RT-qPCR. J Fish Biol 88, 2095-2110.
  2. Dodd A, Curtis PM, Williams LC, Love DA (2000) Zebrafish: bridging the gap between development and disease. Human Molecular Genetics 9, 2443-2449.

Categories