Difference between revisions of "Daucus carota"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) |
|||
Line 27: | Line 27: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GGGAGGTGCAAAGAAAGTTATCA | * F:GGGAGGTGCAAAGAAAGTTATCA | ||
− | * R: | + | * R:TTCCTTTTCATTGACACCAACAA |
|align="center"| 79 | |align="center"| 79 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 40: | Line 40: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:AATGACTCTCGGCAACGGATAT | * F:AATGACTCTCGGCAACGGATAT | ||
− | * R: | + | * R:TCACACCAAGTATCGCATTTCG |
|align="center"| 73 | |align="center"| 73 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 52: | Line 52: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:AGTCGGGTTGTTTGGGAATG | * F:AGTCGGGTTGTTTGGGAATG | ||
− | * R: | + | * R:TCGCCTGTATTTAGCCTTGGA |
|align="center"| 67 | |align="center"| 67 | ||
|align="center"| 60 | |align="center"| 60 |
Revision as of 02:20, 23 June 2017
Contents
Description
- Carrot is the most widely grown member of Apiaceae family. Its progenitor, wild Daucus carota L., is a plant commonly occurring in the temperate climatic zones. To date, a range molecular tools facilitating genome analysis in context of evolutionary history of wild and cultivated carrot have been developed, i.e., DArT, SSR, and SNP markers and a set of ca. 30 resequenced genomes.
- The carrot (Daucus carota subsp. sativus) is a root vegetable, usually orange in colour, though purple, black, red, white, and yellow cultivars exist. Carrots are a domesticated form of the wild carrot, Daucus carota, native to Europe and southwestern Asia. The plant probably originated in Persia and originally cultivated for its leaves and seeds. The most commonly eaten part of the plant is the taproot, although the greens are sometimes eaten as well. The domestic carrot has been selectively bred for its greatly enlarged, more palatable, less woody-textured taproot.
- Daucus carota, whose common names include wild carrot, bird's nest, bishop's lace, and Queen Anne's lace (North America), is a white, flowering plant in the family Apiaceae, native to temperate regions of Europe and southwest Asia, and naturalized to North America and Australia. [1] [2].
- Common Name: Wild carrot
- NCBI Taxonomy
Different Tissues
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GAPDH[1] | Glyceraldehyde 3-phosphate dehydrogenase |
|
AY491512 |
|
79 | 60 | SYBR |
5.8S rRNA[1] | 5.8S, 18S and 25S ribosomal RNA genes and ITS regions |
|
X17534 |
|
73 | 60 | SYBR |
25S rRNA[1] | 5.8S, 18S and 25S ribosomal RNA genes and ITS regions |
|
X17534 |
|
67 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: Hélia Cardoso
- Email: hcardoso@uevora.pt
- Institution: EU Marie Curie Chair, ICAAM, Instituto de Ciências Agrárias e Ambientais Mediterrânicas, IIFA, Universidade de Évora, Ap. 94, 7006-554 Évora, Portugal
Citation Statistics
Cited by 11 (Based on Google Scholar [2017-06-01])
References
- ↑ 1.0 1.1 1.2 1.3 Campos MD, Frederico AM, Nothnagel T, Arnholdt-Schmitt B, Cardoso H (2015) Selection of suitable reference genes for reverse transcription quantitative real-time PCR studies on different experimental systems from carrot (Daucus carota L.). Scientia Horticulturae 186, 115-123.
- ↑ Stelmach K, Macko-Podgórni A, Machaj G, Grzebelus D (2017) Miniature Inverted Repeat Transposable Element Insertions Provide a Source of Intron Length Polymorphism Markers in the Carrot (Daucus carota L.). Frontiers in Plant Science 8.