Difference between revisions of "Daucus carota"
Jump to navigation
Jump to search
ICG Expert3 (talk | contribs) |
Wangzhennan (talk | contribs) |
||
(17 intermediate revisions by 6 users not shown) | |||
Line 1: | Line 1: | ||
==Description== | ==Description== | ||
− | [[File: | + | [[File:Daucus carota.png|right|200px|link=Daucus carota]] |
− | * | + | *'''''Daucus carota subsp. sativus''''', the most widely grown member of Apiaceae family. It is a root vegetable, usually orange in colour, though purple, black, red, white, and yellow cultivars exist. Carrots are a domesticated form of the wild carrot, Daucus carota, native to Europe and southwestern Asia. The plant probably originated in Persia and originally cultivated for its leaves and seeds. The most commonly eaten part of the plant is the taproot, although the greens are sometimes eaten as well. The domestic carrot has been selectively bred for its greatly enlarged, more palatable, less woody-textured taproot<ref name="ref1"/> <ref name="ref2"/>. |
− | + | * <font color=blue>'''Common Name:'''</font> '''Wild carrot''', '''Bird's nest''', '''Bishop's lace''', '''Queen Anne's lace''' | |
− | * | + | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4039 <font color=blue>'''NCBI Taxonomy'''</font>] |
− | =='''''Different | + | =='''''Different Tissues'''''== |
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 13: | Line 13: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 19: | Line 19: | ||
|- | |- | ||
|align="center"| GAPDH<ref name="ref1"/> | |align="center"| GAPDH<ref name="ref1"/> | ||
− | |align="center"| | + | |align="center"| Glyceraldehyde 3-phosphate dehydrogenase |
| | | | ||
* Tap root secondary growth | * Tap root secondary growth | ||
Line 25: | Line 25: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GGGAGGTGCAAAGAAAGTTATCA | * F:GGGAGGTGCAAAGAAAGTTATCA | ||
− | * R: | + | * R:TTCCTTTTCATTGACACCAACAA |
|align="center"| 79 | |align="center"| 79 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 31: | Line 31: | ||
|- | |- | ||
|align="center"| 5.8S rRNA<ref name="ref1"/> | |align="center"| 5.8S rRNA<ref name="ref1"/> | ||
− | |align="center"| | + | |align="center"| 5.8S, 18S and 25S ribosomal RNA genes and ITS regions |
| | | | ||
* Carrot tap root secondary growth | * Carrot tap root secondary growth | ||
Line 38: | Line 38: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:AATGACTCTCGGCAACGGATAT | * F:AATGACTCTCGGCAACGGATAT | ||
− | * R: | + | * R:TCACACCAAGTATCGCATTTCG |
|align="center"| 73 | |align="center"| 73 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 44: | Line 44: | ||
|- | |- | ||
|align="center"| 25S rRNA<ref name="ref1"/> | |align="center"| 25S rRNA<ref name="ref1"/> | ||
− | |align="center"| | + | |align="center"| 5.8S, 18S and 25S ribosomal RNA genes and ITS regions |
| | | | ||
* Somatic embryogenesis realization experiment | * Somatic embryogenesis realization experiment | ||
Line 50: | Line 50: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:AGTCGGGTTGTTTGGGAATG | * F:AGTCGGGTTGTTTGGGAATG | ||
− | * R: | + | * R:TCGCCTGTATTTAGCCTTGGA |
|align="center"| 67 | |align="center"| 67 | ||
|align="center"| 60 | |align="center"| 60 | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|} | |} | ||
− | === | + | |
+ | ===Molecular Types=== | ||
*mRNA | *mRNA | ||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
Line 68: | Line 69: | ||
*'''Institution''': EU Marie Curie Chair, ICAAM, Instituto de Ciências Agrárias e Ambientais Mediterrânicas, IIFA, Universidade de Évora, Ap. 94, 7006-554 Évora, Portugal | *'''Institution''': EU Marie Curie Chair, ICAAM, Instituto de Ciências Agrárias e Ambientais Mediterrânicas, IIFA, Universidade de Évora, Ap. 94, 7006-554 Évora, Portugal | ||
− | ==Citation Statistics== | + | ===Citation Statistics=== |
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=12424538048190119549&as_sdt=2005&sciodt=0,5&hl=en '''14'''] (Based on Google Scholar [2017-09-01]) |
=='''References'''== | =='''References'''== | ||
Line 80: | Line 81: | ||
</ref> | </ref> | ||
</references> | </references> | ||
− | + | =='''Categories'''== | |
[[Category:Plants]] | [[Category:Plants]] | ||
[[Category:mRNA]] | [[Category:mRNA]] | ||
[[Category:SYBR]] | [[Category:SYBR]] | ||
+ | [[Category:Other rRNA]] | ||
+ | [[Category:Different Tissues]] | ||
+ | |||
+ | [[Category:geNorm]] | ||
+ | [[Category:NormFinder]] | ||
+ | [[Category:BestKeeper]] | ||
+ | [[Category:Delta Ct]] | ||
+ | [[Category:RefFinder]] |
Latest revision as of 09:45, 1 September 2017
Contents
Description
- Daucus carota subsp. sativus, the most widely grown member of Apiaceae family. It is a root vegetable, usually orange in colour, though purple, black, red, white, and yellow cultivars exist. Carrots are a domesticated form of the wild carrot, Daucus carota, native to Europe and southwestern Asia. The plant probably originated in Persia and originally cultivated for its leaves and seeds. The most commonly eaten part of the plant is the taproot, although the greens are sometimes eaten as well. The domestic carrot has been selectively bred for its greatly enlarged, more palatable, less woody-textured taproot[1] [2].
- Common Name: Wild carrot, Bird's nest, Bishop's lace, Queen Anne's lace
- NCBI Taxonomy
Different Tissues
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GAPDH[1] | Glyceraldehyde 3-phosphate dehydrogenase |
|
AY491512 |
|
79 | 60 | SYBR |
5.8S rRNA[1] | 5.8S, 18S and 25S ribosomal RNA genes and ITS regions |
|
X17534 |
|
73 | 60 | SYBR |
25S rRNA[1] | 5.8S, 18S and 25S ribosomal RNA genes and ITS regions |
|
X17534 |
|
67 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: Hélia Cardoso
- Email: hcardoso@uevora.pt
- Institution: EU Marie Curie Chair, ICAAM, Instituto de Ciências Agrárias e Ambientais Mediterrânicas, IIFA, Universidade de Évora, Ap. 94, 7006-554 Évora, Portugal
Citation Statistics
Cited by 14 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 Campos MD, Frederico AM, Nothnagel T, Arnholdt-Schmitt B, Cardoso H (2015) Selection of suitable reference genes for reverse transcription quantitative real-time PCR studies on different experimental systems from carrot (Daucus carota L.). Scientia Horticulturae 186, 115-123.
- ↑ Stelmach K, Macko-Podgórni A, Machaj G, Grzebelus D (2017) Miniature Inverted Repeat Transposable Element Insertions Provide a Source of Intron Length Polymorphism Markers in the Carrot (Daucus carota L.). Frontiers in Plant Science 8.
Categories