Difference between revisions of "Daucus carota"

From ICG
Jump to navigation Jump to search
 
(17 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2015002-1.jpg|right|227px|]]
+
[[File:Daucus carota.png|right|200px|link=Daucus carota]]
* Carrot is the most widely grown member of Apiaceae family. Its progenitor, wild Daucus carota L., is a plant commonly occurring in the temperate climatic zones. To date, a range molecular tools facilitating genome analysis in context of evolutionary history of wild and cultivated carrot have been developed, i.e., DArT, SSR, and SNP markers and a set of ca. 30 resequenced genomes.
+
*'''''Daucus carota subsp. sativus''''', the most widely grown member of Apiaceae family. It is a root vegetable, usually orange in colour, though purple, black, red, white, and yellow cultivars exist. Carrots are a domesticated form of the wild carrot, Daucus carota, native to Europe and southwestern Asia. The plant probably originated in Persia and originally cultivated for its leaves and seeds. The most commonly eaten part of the plant is the taproot, although the greens are sometimes eaten as well. The domestic carrot has been selectively bred for its greatly enlarged, more palatable, less woody-textured taproot<ref name="ref1"/> <ref name="ref2"/>.
* The carrot (Daucus carota subsp. sativus) is a root vegetable, usually orange in colour, though purple, black, red, white, and yellow cultivars exist. Carrots are a domesticated form of the wild carrot, Daucus carota, native to Europe and southwestern Asia. The plant probably originated in Persia and originally cultivated for its leaves and seeds. The most commonly eaten part of the plant is the taproot, although the greens are sometimes eaten as well. The domestic carrot has been selectively bred for its greatly enlarged, more palatable, less woody-textured taproot.
+
* <font color=blue>'''Common Name:'''</font> '''Wild carrot''', '''Bird's nest''', '''Bishop's lace''', '''Queen Anne's lace'''
* Daucus carota, whose common names include wild carrot, bird's nest, bishop's lace, and Queen Anne's lace (North America), is a white, flowering plant in the family Apiaceae, native to temperate regions of Europe and southwest Asia, and naturalized to North America and Australia. <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4039 <font color=blue>'''NCBI Taxonomy'''</font>]
  
=='''''Different Experimental Systems'''''==
+
=='''''Different Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 19: Line 19:
 
|-
 
|-
 
|align="center"| GAPDH<ref name="ref1"/>
 
|align="center"| GAPDH<ref name="ref1"/>
|align="center"| glyceraldehyde 3-phosphate dehydrogenase  
+
|align="center"| Glyceraldehyde 3-phosphate dehydrogenase  
 
|
 
|
 
* Tap root secondary growth  
 
* Tap root secondary growth  
Line 25: Line 25:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GGGAGGTGCAAAGAAAGTTATCA
 
* F:GGGAGGTGCAAAGAAAGTTATCA
* R:GGGAGGTGCAAAGAAAGTTATCA
+
* R:TTCCTTTTCATTGACACCAACAA
 
|align="center"|  79  
 
|align="center"|  79  
 
|align="center"| 60
 
|align="center"| 60
Line 31: Line 31:
 
|-
 
|-
 
|align="center"| 5.8S rRNA<ref name="ref1"/>
 
|align="center"| 5.8S rRNA<ref name="ref1"/>
|align="center"| ''D.carota'' 5.8S, 18S and 25S ribosomal RNA genes and ITS regions  
+
|align="center"| 5.8S, 18S and 25S ribosomal RNA genes and ITS regions  
 
|
 
|
 
* Carrot tap root secondary growth  
 
* Carrot tap root secondary growth  
Line 38: Line 38:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:AATGACTCTCGGCAACGGATAT
 
* F:AATGACTCTCGGCAACGGATAT
* R:AATGACTCTCGGCAACGGATAT
+
* R:TCACACCAAGTATCGCATTTCG
 
|align="center"|  73  
 
|align="center"|  73  
 
|align="center"| 60
 
|align="center"| 60
Line 44: Line 44:
 
|-
 
|-
 
|align="center"| 25S rRNA<ref name="ref1"/>
 
|align="center"| 25S rRNA<ref name="ref1"/>
|align="center"| ''D.carota'' 5.8S, 18S and 25S ribosomal RNA genes and ITS regions  
+
|align="center"| 5.8S, 18S and 25S ribosomal RNA genes and ITS regions  
 
|
 
|
 
* Somatic embryogenesis realization experiment
 
* Somatic embryogenesis realization experiment
Line 50: Line 50:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:AGTCGGGTTGTTTGGGAATG
 
* F:AGTCGGGTTGTTTGGGAATG
* R:AGTCGGGTTGTTTGGGAATG
+
* R:TCGCCTGTATTTAGCCTTGGA
 
|align="center"|  67  
 
|align="center"|  67  
 
|align="center"| 60
 
|align="center"| 60
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer Types===
+
 
 +
===Molecular Types===
 
*mRNA
 
*mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 68: Line 69:
 
*'''Institution''': EU Marie Curie Chair, ICAAM, Instituto de Ciências Agrárias e Ambientais Mediterrânicas, IIFA, Universidade de Évora, Ap. 94, 7006-554 Évora, Portugal
 
*'''Institution''': EU Marie Curie Chair, ICAAM, Instituto de Ciências Agrárias e Ambientais Mediterrânicas, IIFA, Universidade de Évora, Ap. 94, 7006-554 Évora, Portugal
  
==Citation Statistics==
+
===Citation Statistics===
Cited by '''11''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=12424538048190119549&as_sdt=2005&sciodt=0,5&hl=en '''14'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 80: Line 81:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Plants]]
 
[[Category:Plants]]
 
[[Category:mRNA]]   
 
[[Category:mRNA]]   
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 +
[[Category:Other rRNA]]
 +
[[Category:Different Tissues]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]

Latest revision as of 09:45, 1 September 2017

Description

Daucus carota.png
  • Daucus carota subsp. sativus, the most widely grown member of Apiaceae family. It is a root vegetable, usually orange in colour, though purple, black, red, white, and yellow cultivars exist. Carrots are a domesticated form of the wild carrot, Daucus carota, native to Europe and southwestern Asia. The plant probably originated in Persia and originally cultivated for its leaves and seeds. The most commonly eaten part of the plant is the taproot, although the greens are sometimes eaten as well. The domestic carrot has been selectively bred for its greatly enlarged, more palatable, less woody-textured taproot[1] [2].
  • Common Name: Wild carrot, Bird's nest, Bishop's lace, Queen Anne's lace
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Tap root secondary growth
AY491512
  • F:GGGAGGTGCAAAGAAAGTTATCA
  • R:TTCCTTTTCATTGACACCAACAA
79 60 SYBR
5.8S rRNA[1] 5.8S, 18S and 25S ribosomal RNA genes and ITS regions
  • Carrot tap root secondary growth
  • Somatic embryogenesis realization experiment
X17534
  • F:AATGACTCTCGGCAACGGATAT
  • R:TCACACCAAGTATCGCATTTCG
73 60 SYBR
25S rRNA[1] 5.8S, 18S and 25S ribosomal RNA genes and ITS regions
  • Somatic embryogenesis realization experiment
X17534
  • F:AGTCGGGTTGTTTGGGAATG
  • R:TCGCCTGTATTTAGCCTTGGA
67 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Hélia Cardoso
  • Email: hcardoso@uevora.pt
  • Institution: EU Marie Curie Chair, ICAAM, Instituto de Ciências Agrárias e Ambientais Mediterrânicas, IIFA, Universidade de Évora, Ap. 94, 7006-554 Évora, Portugal

Citation Statistics

Cited by 14 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Campos MD, Frederico AM, Nothnagel T, Arnholdt-Schmitt B, Cardoso H (2015) Selection of suitable reference genes for reverse transcription quantitative real-time PCR studies on different experimental systems from carrot (Daucus carota L.). Scientia Horticulturae 186, 115-123.
  2. Stelmach K, Macko-Podgórni A, Machaj G, Grzebelus D (2017) Miniature Inverted Repeat Transposable Element Insertions Provide a Source of Intron Length Polymorphism Markers in the Carrot (Daucus carota L.). Frontiers in Plant Science 8.

Categories