Difference between revisions of "Daucus carota"

From ICG
Jump to navigation Jump to search
 
(3 intermediate revisions by 3 users not shown)
Line 6: Line 6:
  
 
=='''''Different Tissues'''''==
 
=='''''Different Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 70: Line 70:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''11''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=12424538048190119549&as_sdt=2005&sciodt=0,5&hl=en '''14'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 81: Line 81:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Plants]]
 
[[Category:Plants]]
 
[[Category:mRNA]]   
 
[[Category:mRNA]]   
Line 87: Line 87:
 
[[Category:Other rRNA]]
 
[[Category:Other rRNA]]
 
[[Category:Different Tissues]]
 
[[Category:Different Tissues]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]

Latest revision as of 09:45, 1 September 2017

Description

Daucus carota.png
  • Daucus carota subsp. sativus, the most widely grown member of Apiaceae family. It is a root vegetable, usually orange in colour, though purple, black, red, white, and yellow cultivars exist. Carrots are a domesticated form of the wild carrot, Daucus carota, native to Europe and southwestern Asia. The plant probably originated in Persia and originally cultivated for its leaves and seeds. The most commonly eaten part of the plant is the taproot, although the greens are sometimes eaten as well. The domestic carrot has been selectively bred for its greatly enlarged, more palatable, less woody-textured taproot[1] [2].
  • Common Name: Wild carrot, Bird's nest, Bishop's lace, Queen Anne's lace
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Tap root secondary growth
AY491512
  • F:GGGAGGTGCAAAGAAAGTTATCA
  • R:TTCCTTTTCATTGACACCAACAA
79 60 SYBR
5.8S rRNA[1] 5.8S, 18S and 25S ribosomal RNA genes and ITS regions
  • Carrot tap root secondary growth
  • Somatic embryogenesis realization experiment
X17534
  • F:AATGACTCTCGGCAACGGATAT
  • R:TCACACCAAGTATCGCATTTCG
73 60 SYBR
25S rRNA[1] 5.8S, 18S and 25S ribosomal RNA genes and ITS regions
  • Somatic embryogenesis realization experiment
X17534
  • F:AGTCGGGTTGTTTGGGAATG
  • R:TCGCCTGTATTTAGCCTTGGA
67 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Hélia Cardoso
  • Email: hcardoso@uevora.pt
  • Institution: EU Marie Curie Chair, ICAAM, Instituto de Ciências Agrárias e Ambientais Mediterrânicas, IIFA, Universidade de Évora, Ap. 94, 7006-554 Évora, Portugal

Citation Statistics

Cited by 14 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Campos MD, Frederico AM, Nothnagel T, Arnholdt-Schmitt B, Cardoso H (2015) Selection of suitable reference genes for reverse transcription quantitative real-time PCR studies on different experimental systems from carrot (Daucus carota L.). Scientia Horticulturae 186, 115-123.
  2. Stelmach K, Macko-Podgórni A, Machaj G, Grzebelus D (2017) Miniature Inverted Repeat Transposable Element Insertions Provide a Source of Intron Length Polymorphism Markers in the Carrot (Daucus carota L.). Frontiers in Plant Science 8.

Categories