Difference between revisions of "Diabrotica virgifera virgifera"

From ICG
Jump to navigation Jump to search
 
(10 intermediate revisions by 4 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:Diabrotica virgifera virgifera-1.jpg|right|200px|link=Diabrotica virgifera virgifera]]
 
[[File:Diabrotica virgifera virgifera-1.jpg|right|200px|link=Diabrotica virgifera virgifera]]
* The western corn rootworm (WCR), '''''Diabrotica v. virgifera''''', is one of the most important insect pests of cultivated maize in North America with annual losses in yield and control expenditures exceeding U.S. $1 billion annually. A number of strategies, such as chemical insecticides, crop rotation, biological control and transgenic plants expressing toxins from Bacillus thuringiensis (Bt), have been used to manage rootworm populations<ref name="ref1"/>.
+
* The western corn rootworm (WCR), '''''Diabrotica v. virgifera''''', is one of the most important insect pests of cultivated maize in North America with annual losses in yield and control expenditures exceeding U.S. $1 billion annually. A number of strategies, such as chemical insecticides, crop rotation, biological control and transgenic plants expressing toxins from Bacillus thuringiensis (Bt), have been used to manage rootworm populations <ref name="ref1"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Western corn rootworm'''
 
* <font color=blue>'''Common Name:'''</font> '''Western corn rootworm'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=50390<font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=50390<font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
=='''''Different Developmental Stages & Tissues'''''==
 
=='''''Different Developmental Stages & Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 53: Line 54:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer types===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 63: Line 66:
 
*'''Name''': Thaı ´s Barros Rodrigues
 
*'''Name''': Thaı ´s Barros Rodrigues
 
*'''Email''': thaisbarros.bio@gmail.com
 
*'''Email''': thaisbarros.bio@gmail.com
*'''Institute''': CAPES Foundation, Ministry of Education of Brazil, Brası ´lia, Federal District, Brazil, and Federal University of Lavras, Lavras, Minas Gerais, Brazil
+
*'''Institution''': CAPES Foundation, Ministry of Education of Brazil, Brası ´lia, Federal District, Brazil, and Federal University of Lavras, Lavras, Minas Gerais, Brazil
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''??''' (Based on Google Scholar [2017-08-01])
+
Cited by [https://scholar.google.com/scholar?cites=14390878179536842400&as_sdt=2005&sciodt=0,5&hl=en '''18'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
Rodrigues TB, Khajuria C, Wang H, Matz N, Cunha Cardoso D, Valicente FH, Zhou
+
Rodrigues, Thaís Barros, et al. Validation of reference housekeeping genes for gene expression studies in western corn rootworm (Diabrotica virgifera virgifera). PLoS One 9.10 (2014): e109825.
X, Siegfried B. Validation of reference housekeeping genes for gene expression
 
studies in western corn rootworm (Diabrotica virgifera virgifera). PLoS One. 2014
 
Oct 30;9(10):e109825. doi: 10.1371/journal.pone.0109825. eCollection 2014.
 
Erratum in: PLoS One. 2015;10(4):e0124187. Barros Rodrigues, Thaís [corrected to
 
Rodrigues, Thaís Barros]. PubMed PMID: 25356627; PubMed Central PMCID:
 
PMC4214676.
 
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 
[[Category:Different Developmental Stages]] [[Category:Different Tissues]]
 
[[Category:Different Developmental Stages]] [[Category:Different Tissues]]
 
[[Category:ACT]] [[Category:RPS]] [[Category:EF1α]]
 
[[Category:ACT]] [[Category:RPS]] [[Category:EF1α]]
 
[[Category:Animals]]
 
[[Category:Animals]]
 +
[[Category:SYBR]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]

Latest revision as of 05:14, 1 September 2017

Description

Diabrotica virgifera virgifera-1.jpg
  • The western corn rootworm (WCR), Diabrotica v. virgifera, is one of the most important insect pests of cultivated maize in North America with annual losses in yield and control expenditures exceeding U.S. $1 billion annually. A number of strategies, such as chemical insecticides, crop rotation, biological control and transgenic plants expressing toxins from Bacillus thuringiensis (Bt), have been used to manage rootworm populations [1].
  • Common Name: Western corn rootworm
  • NCBI Taxonomy

Different Developmental Stages & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
β-actin[1] actin 2
  • Different life stages
NM_001164951
  • F:TCCAGGCTGTACTCTCCTTG
  • R:CAAGTCCAAACGAAGGATTG
133 60 SYBR
RPS9[1] ribosomal protein S9
  • dsRNA treatments
XM_001608220
  • F:AATGTGTCGTTGTCTGAT
  • R:GTCGTTTGGTTCGTATTG
170 60 SYBR
EF1α[1] elongation factor-1α
  • Bt exposure and among different tissues
XM_003705302
  • F:ACCAGATTTGATGGCTTTGG
  • R:CACCCAGAGGAGCTTCAGAC
194 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Thaı ´s Barros Rodrigues
  • Email: thaisbarros.bio@gmail.com
  • Institution: CAPES Foundation, Ministry of Education of Brazil, Brası ´lia, Federal District, Brazil, and Federal University of Lavras, Lavras, Minas Gerais, Brazil

Citation Statistics

Cited by 18 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Rodrigues, Thaís Barros, et al. Validation of reference housekeeping genes for gene expression studies in western corn rootworm (Diabrotica virgifera virgifera). PLoS One 9.10 (2014): e109825.

Categories