Difference between revisions of "Dicentrarchus labrax"

From ICG
Jump to navigation Jump to search
 
(14 intermediate revisions by 5 users not shown)
Line 1: Line 1:
==Description==
+
=='''Description'''==
[[File:REFqPCR200901.jpg|right|272px|]]
+
[[File:Dicentrarchus labrax.png|right|200px|link=Dicentrarchus labrax]]
* The European seabass (Dicentrarchus labrax) was the first non-salmonid marine fish species to be commercially cultured in Europe. Today D. labrax is along with the gilthead seabream (Sparus aurata) one of the most extensively aquacultured fish species in the Mediterranean and as the economic pressure on producers is steadily increasing the improvement of aquaculture techniques is significant.<ref name="ref1"/> .
+
* '''''Dicentrarchus labrax''''' is the first non-salmonid marine fish species to be commercially cultured in Europe. It is a major aquaculture species in the Mediterranean region and in the southern part of the north east Atlantic Ocean. Its domestication began in the 1980s, and while some breeding programs are starting (France, Greece, Israel), some hatcheries still use wild broodstock. Breeding programs are expected to provide important increases in productivity, because heritabilities of growth traits range from medium to high in this species<ref name="ref1"/> .
 +
* <font color=blue>'''Common Name:'''</font> '''European bass''', '''European seabass'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=13489 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Developmental Stages & Tissues'''''==
 
=='''''Different Developmental Stages & Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 29: Line 31:
 
|-
 
|-
 
|align="center"| L13a<ref name="ref1"/>
 
|align="center"| L13a<ref name="ref1"/>
|align="center"| ribosomal protein L13 a
+
|align="center"| Ribosomal protein L13 a
 
|
 
|
 
* Different developmental stages & Tissues
 
* Different developmental stages & Tissues
Line 53: Line 55:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
Line 65: Line 68:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''55''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=10927542979708850692&as_sdt=2005&sciodt=0,5&hl=en '''57'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 78: Line 81:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
Line 84: Line 87:
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:EF1α]] [[Category:EF1α]] [[Category:RPL]]
 
[[Category:EF1α]] [[Category:EF1α]] [[Category:RPL]]
 +
[[Category:Different Tissues]]  [[Category:Different Developmental Stages]]
 +
 +
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 07:09, 1 September 2017

Description

Dicentrarchus labrax.png
  • Dicentrarchus labrax is the first non-salmonid marine fish species to be commercially cultured in Europe. It is a major aquaculture species in the Mediterranean region and in the southern part of the north east Atlantic Ocean. Its domestication began in the 1980s, and while some breeding programs are starting (France, Greece, Israel), some hatcheries still use wild broodstock. Breeding programs are expected to provide important increases in productivity, because heritabilities of growth traits range from medium to high in this species[1] .
  • Common Name: European bass, European seabass
  • NCBI Taxonomy

Different Developmental Stages & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ef-1α [1] Ef-1 alpha
  • Different developmental stages
FM019753
  • F:AGATGACCACGAGTCTCTGC
  • R:CTTGGGTGGGTCGTTCTTG
NA 57 SYBR
L13a[1] Ribosomal protein L13 a
  • Different developmental stages & Tissues
DT044539
  • F:TCTGGAGGACTGTCAGGGGCATGC
  • R:AGACGCACAATCTTGAGAGCAG
NA 57 SYBR
Fau[1] 40S ribosomal protein S30
  • Different Tissues
FM004681
  • F:GACACCCAAGGTTGACAAGCAG
  • R:GGCATTGAAGCACTTAGGAGTTG
NA 57 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Elena Sarropoulou
  • Email: sarris@her.hcmr.gr
  • Institution: Institute of Marine Biology and Genetics, Hellenic Center of Marine Research, Crete, P.O. Box 2214, 710 03 Iraklio, Crete, Greece

Citation Statistics

Cited by 57 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Mitter K, Kotoulas G, Magoulas A, Mulero V, Sepulcre P, Figueras A, Novoa B, Sarropoulou E. Evaluation of candidate reference genes for QPCR during ontogenesis and of immune-relevant tissues of European seabass (Dicentrarchus labrax). Comp Biochem Physiol B Biochem Mol Biol. 2009 Aug;153(4):340-7. doi: 10.1016/j.cbpb.2009.04.009. Epub 2009 May 3. Erratum in: Comp Biochem Physiol B Biochem Mol Biol. 2009 Nov;154(3):372. PubMed PMID: 19398033.

Categories