Difference between revisions of "Dicentrarchus labrax"

Revision as of 15:18, 23 June 2017

The European seabass (Dicentrarchus labrax) was the first non-salmonid marine fish species to be commercially cultured in Europe. Today D. labrax is along with the gilthead seabream (Sparus aurata) one of the most extensively aquacultured fish species in the Mediterranean and as the economic pressure on producers is steadily increasing the improvement of aquaculture techniques is significant.^[1] .

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Ef-1α ^[1]	Ef-1 alpha	Different developmental stages	FM019753	F:AGATGACCACGAGTCTCTGC R:CTTGGGTGGGTCGTTCTTG	NA	57	SYBR
L13a^[1]	Ribosomal protein L13 a	Different developmental stages & Tissues	DT044539	F:TCTGGAGGACTGTCAGGGGCATGC R:AGACGCACAATCTTGAGAGCAG	NA	57	SYBR
Fau^[1]	40S ribosomal protein S30	Different Tissues	FM004681	F:GACACCCAAGGTTGACAAGCAG R:GGCATTGAAGCACTTAGGAGTTG	NA	57	SYBR

Name: Elena Sarropoulou
Email: sarris@her.hcmr.gr
Institution: Institute of Marine Biology and Genetics, Hellenic Center of Marine Research, Crete, P.O. Box 2214, 710 03 Iraklio, Crete, Greece

Cited by 56 (Based on Google Scholar [2017-06-23])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Mitter K, Kotoulas G, Magoulas A, Mulero V, Sepulcre P, Figueras A, Novoa B, Sarropoulou E. Evaluation of candidate reference genes for QPCR during ontogenesis and of immune-relevant tissues of European seabass (Dicentrarchus labrax). Comp Biochem Physiol B Biochem Mol Biol. 2009 Aug;153(4):340-7. doi: 10.1016/j.cbpb.2009.04.009. Epub 2009 May 3. Erratum in: Comp Biochem Physiol B Biochem Mol Biol. 2009 Nov;154(3):372. PubMed PMID: 19398033.

@@ Line 66: / Line 66: @@
 ===Citation Statistics===
-Cited by '''55''' (Based on Google Scholar [2017-06-01])
+Cited by '''56''' (Based on Google Scholar [2017-06-23])
 =='''References'''==