Dicentrarchus labrax

From ICG
Jump to navigation Jump to search

Description

REFqPCR200901.jpg
  • The European seabass (Dicentrarchus labrax) was the first non-salmonid marine fish species to be commercially cultured in Europe. Today D. labrax is along with the gilthead seabream (Sparus aurata) one of the most extensively aquacultured fish species in the Mediterranean and as the economic pressure on producers is steadily increasing the improvement of aquaculture techniques is significant.[1] .

Different Developmental Stages & Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ef-1α [1] Ef-1 alpha
  • Different developmental stages
FM019753
  • F:AGATGACCACGAGTCTCTGC
  • R:CTTGGGTGGGTCGTTCTTG
NA 57 SYBR
L13a[1] Ribosomal protein L13 a
  • Different developmental stages & Tissues
DT044539
  • F:TCTGGAGGACTGTCAGGGGCATGC
  • R:AGACGCACAATCTTGAGAGCAG
NA 57 SYBR
Fau[1] 40S ribosomal protein S30
  • Different Tissues
FM004681
  • F:GACACCCAAGGTTGACAAGCAG
  • R:GGCATTGAAGCACTTAGGAGTTG
NA 57 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Elena Sarropoulou
  • Email: sarris@her.hcmr.gr
  • Institution: Institute of Marine Biology and Genetics, Hellenic Center of Marine Research, Crete, P.O. Box 2214, 710 03 Iraklio, Crete, Greece

Citation Statistics

Cited by 56 (Based on Google Scholar [2017-06-23])

References

  1. 1.0 1.1 1.2 1.3 Mitter K, Kotoulas G, Magoulas A, Mulero V, Sepulcre P, Figueras A, Novoa B, Sarropoulou E. Evaluation of candidate reference genes for QPCR during ontogenesis and of immune-relevant tissues of European seabass (Dicentrarchus labrax). Comp Biochem Physiol B Biochem Mol Biol. 2009 Aug;153(4):340-7. doi: 10.1016/j.cbpb.2009.04.009. Epub 2009 May 3. Erratum in: Comp Biochem Physiol B Biochem Mol Biol. 2009 Nov;154(3):372. PubMed PMID: 19398033.