Difference between revisions of "Dimocarpus longan"

From ICG
Jump to navigation Jump to search
Line 26: Line 26:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GCCGACTACAACATCCAGAAG
 
* F:GCCGACTACAACATCCAGAAG
* R:GCTTGGTGTA GGTCTTCTTC TT
+
* R:GCTTGGTGTAGGTCTTCTTCTT
 
|align="center"| 94
 
|align="center"| 94
 
|align="center"| 53~64
 
|align="center"| 53~64
Line 38: Line 38:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GATGATTCCCACCAAGCCCAT
 
* F:GATGATTCCCACCAAGCCCAT
* R:GGGTCCTTCT TCTCAACACT CT
+
* R:GGGTCCTTCTTCTCAACACTCT
 
|align="center"| 76
 
|align="center"| 76
 
|align="center"| 53~64
 
|align="center"| 53~64
Line 49: Line 49:
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EU330204 '''EU330204''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EU330204 '''EU330204''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:GGTCAGATGG TGAAGCCGTA GAG
+
* F:GGTCAGATGGTGAAGCCGTAGAG
 
* R:GTCTATGCCACCGATACAACAAACCC
 
* R:GTCTATGCCACCGATACAACAAACCC
 
|align="center"| 106
 
|align="center"| 106

Revision as of 14:46, 20 June 2017

Description

Dimocarpus longan-1.jpg
  • Longan (Dimocarpus longan Lour.), an important subtropical fruit in the family Sapindaceae, is grown in more than 10 countries. Longan is an edible drupe fruit and a source of traditional medicine with polyphenol-rich traits. Tree size, alternate bearing, and witches' broom disease still pose serious problems.
  • It is originated from South China or Southeast Asia and is commonly called longan or “dragon eye” in Asia. It is an important tropical/subtropical evergreen fruit tree that has a diploid genome (2n = 2x = 30) and belongs to the family Sapindaceae. Longan is widely cultivated in Southeast Asia, South Asia, Australia, and Hawaii.
  • China's longan acreage and production rank first, accounting for 70% and more than 50% of the world's acreage and production, respectively[1] [2] .

Somatic Embryogenesis

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBQ [1] Ubiquitin
  • At different developmental stages at different temperatures
JQ678782
  • F:GCCGACTACAACATCCAGAAG
  • R:GCTTGGTGTAGGTCTTCTTCTT
94 53~64 SYBR
EF-1α[1] Eukaryotic elongation factor 1-alpha
  • At different developmental stages at different temperatures
DQ471426
  • F:GATGATTCCCACCAAGCCCAT
  • R:GGGTCCTTCTTCTCAACACTCT
76 53~64 SYBR
Fe-SOD[1] Iron-superoxide dismutase
  • At different developmental stages at different temperatures
EU330204
  • F:GGTCAGATGGTGAAGCCGTAGAG
  • R:GTCTATGCCACCGATACAACAAACCC
106 53~64 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Z.X. Lai
  • Email: Laizx01@163.com
  • Institution: Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China

Citation Statistics

Cited by 131 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Lin Y L, Lai Z X. Reference gene selection for qPCR analysis during somatic embryogenesis in longan tree[J]. Plant Science, 2010, 178(4): 359-365.
  2. Lin Y, Min J, Lai R, Wu Z, Chen Y, Yu L, Cheng C, Jin Y, Tian Q, Liu Q, Liu W, Zhang C, Lin L, Zhang D, Thu M, Zhang Z, Liu S, Zhong C, Fang X, Wang J, Yang H, Varshney RK, Yin Y, Lai Z.Gigascience. 2017 May 1;6(5):1-14. doi: 10.1093/gigascience/gix023.PMID: 28368449.