Difference between revisions of "Dimocarpus longan"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) |
ICG Expert4 (talk | contribs) |
||
Line 26: | Line 26: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GCCGACTACAACATCCAGAAG | * F:GCCGACTACAACATCCAGAAG | ||
− | * R: | + | * R:GCTTGGTGTAGGTCTTCTTCTT |
|align="center"| 94 | |align="center"| 94 | ||
|align="center"| 53~64 | |align="center"| 53~64 | ||
Line 38: | Line 38: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GATGATTCCCACCAAGCCCAT | * F:GATGATTCCCACCAAGCCCAT | ||
− | * R: | + | * R:GGGTCCTTCTTCTCAACACTCT |
|align="center"| 76 | |align="center"| 76 | ||
|align="center"| 53~64 | |align="center"| 53~64 | ||
Line 49: | Line 49: | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EU330204 '''EU330204'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EU330204 '''EU330204'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
− | * F: | + | * F:GGTCAGATGGTGAAGCCGTAGAG |
* R:GTCTATGCCACCGATACAACAAACCC | * R:GTCTATGCCACCGATACAACAAACCC | ||
|align="center"| 106 | |align="center"| 106 |
Revision as of 14:46, 20 June 2017
Contents
Description
- Longan (Dimocarpus longan Lour.), an important subtropical fruit in the family Sapindaceae, is grown in more than 10 countries. Longan is an edible drupe fruit and a source of traditional medicine with polyphenol-rich traits. Tree size, alternate bearing, and witches' broom disease still pose serious problems.
- It is originated from South China or Southeast Asia and is commonly called longan or “dragon eye” in Asia. It is an important tropical/subtropical evergreen fruit tree that has a diploid genome (2n = 2x = 30) and belongs to the family Sapindaceae. Longan is widely cultivated in Southeast Asia, South Asia, Australia, and Hawaii.
- China's longan acreage and production rank first, accounting for 70% and more than 50% of the world's acreage and production, respectively[1] [2] .
Somatic Embryogenesis
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
UBQ [1] | Ubiquitin |
|
JQ678782 |
|
94 | 53~64 | SYBR |
EF-1α[1] | Eukaryotic elongation factor 1-alpha |
|
DQ471426 |
|
76 | 53~64 | SYBR |
Fe-SOD[1] | Iron-superoxide dismutase |
|
EU330204 |
|
106 | 53~64 | SYBR |
Moleculer Type
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Z.X. Lai
- Email: Laizx01@163.com
- Institution: Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China
Citation Statistics
Cited by 131 (Based on Google Scholar [2017-06-16])
References
- ↑ 1.0 1.1 1.2 1.3 Lin Y L, Lai Z X. Reference gene selection for qPCR analysis during somatic embryogenesis in longan tree[J]. Plant Science, 2010, 178(4): 359-365.
- ↑ Lin Y, Min J, Lai R, Wu Z, Chen Y, Yu L, Cheng C, Jin Y, Tian Q, Liu Q, Liu W, Zhang C, Lin L, Zhang D, Thu M, Zhang Z, Liu S, Zhong C, Fang X, Wang J, Yang H, Varshney RK, Yin Y, Lai Z.Gigascience. 2017 May 1;6(5):1-14. doi: 10.1093/gigascience/gix023.PMID: 28368449.